Polygonatum odoratum
(Mill.) Druce · speciesAt a glance
Occurrence records140 596
Data sources14
Biological traits58
DNA specimens27
eDNA detections29
Sources14 archives
Databases and archives Polygonatum odoratum's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility140 596 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Chemical compositionLOTUS · NPASS82 compounds
Occurrence & distributionGBIF140 596 records
Environmental DNA1 datasets · 2 countries29 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT9.8 Gbp
01Narrative
Polygonatum odoratum (syn. P. officinale), the angular Solomon's seal or scented Solomon's seal, is a species of flowering plant in the family Asparagaceae, native to Europe, the Caucasus, Siberia, the Russian Far East, China, Mongolia, Korea and Japan.Kew World Checklist of Selected Plant FamiliesFlora of China, Vol. 24 Page 226, 玉竹 yu zhu, Polygonatum odoratum (Miller) Druce, Ann. Scott. Nat. Hist. 60: 226. 1906.Altervista Flora Italiana, Sigillo di Salomone comune, Angular Solomon's Seal, Polygonatum odoratum (Miller) Druce includes map of distribution in Europe In the United Kingdom it is one of three native species of the genus, the others being P. multiflorum and P. verticillatum. The genus name Polygonatum comes from the Greek words "poly", meaning "many", and "gonu", meaning "knee joint". This is in reference to the plant's jointed rhizomes. The Latin specific epithet odoratum means "scented".
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology21
Fruit length8.8 mm
Fruit length max10 mm
Fruit length min7 mm
Fruit width8.85 mm
Fruit width max10 mm
Fruit width min7 mm
Leaf length85 mm
Leaf length max120 mm
Leaf length min50 mm
Leaf mass86.84 mg
Leaf size1 125 mm²
⚠ sources differ — TRY: 1 125 mm² · LEDA: 2 270 mm² · GIFT: 2 270 mm²
Leaf width max160 mm
Leaf width min30 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · LEDA: 0.3 m · TRY: 0.2 m
Plant height generative0.15 m
Plant height max1 m
Plant height min0.15 m
Seed length4 mm
Seed mass33.32 mg
⚠ sources differ — TRY: 33.32 mg · LEDA: 251 mg · GIFT: 86.88 mg
Seed mass max37.3 mg
Seed mass min21.42 mg
Life cycle & reproduction13
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formrhizomatous subshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number27.35
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean1 750 m
Elevation min500 m
Epiphyteterrestrial
Fruit typeberry
Growth formherb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio14.4 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)183 mg/g
⚠ sources differ — TRY: 183 mg/g · LEDA: 167 mg/g
Leaf n27.7 mg/g
Leaf p3.79 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)33.2 mm²/mg
Wood density180 mg/cm³
Other traits1
Diaspore typefruit
03Chemical composition82 compounds
Compounds documented for Polygonatum odoratum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cholestane steroids $ Spirostane steroids5
Hydrocarbons5
Isoflavanones5
Branched fatty acids $ Unsaturated fatty acids4
Cinnamic acid amides4
Documented compounds82 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-3-Carene | present | NPASS | |
| (+)-alpha-Carene | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-Camphene | present | NPASS | |
| (+)-Syringaresinol | present | NPASS | |
| (-)-Camphene | present | NPASS | |
| (-)-Syringaresinol | present | NPASS | |
| (1R,2R,4S,5'S,6R,7S,8R,9R,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-2,16-diol | present | LOTUS | |
| (1R,3S,6S,8R,11S,12S,15R,16R)-15-[(2R,5R)-5-hydroxy-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | LOTUS | |
| (24R)-9,19-cycloart-25-ene-3beta,24-diol | present | LOTUS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonatum odoratum has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes5
GenBank sequences10
eDNA detections29
Countries4
The DNA barcodea real sequence read deposited for this species
TAAGGGAGCTATACCCAATATCTTATGAAAACAAGATATTGGGTATGACTCCTTCAACGATTCTTAATACATATACATTAAGACGGAAAT …
Polygonatum odoratum chloroplast, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL8★ITS★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Polygonatum odoratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size9 801 456 122 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Polygonatum odoratum9.8 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records16–402n range20median20mode126records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 20103×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +16
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — PAGNI A.M., CORSI G. - 1979. Cariologia di alcune specie d'interesse officinale della flora italiana.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 86: 465-473.
CCDB · ita-fl — GARBARI F., TORNADORE N. - 1972. Numeri cromosomici per la flora italiana:108-123.. Inform. Bot. Ital. , 4(1): 60-66.
CCDB · ita-fl — SCRUGLI A. - 1982. Numeri cromosomici per la flora italiana:868-872.. Inform. Bot. Ital. , 14(2-3): 229-233.
CCDB · ita-fl — MORI M. - 1957. Note brevi. Il numero cromosomico diploide di alcune specie di angiosperme raccolte nella tenuta di S. Rossore (Pisa).. Caryologia , 9(2): 365-368.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Bernátová D., 2007: [New records in Betonica, Buphtalmum, Dianthus, Pilosella, Polygonatum, Prenanthes, Ranunculus, Silene, Solidago, Tragopogon, Trifolium, and Tussilago], pp. 125, 135, 225, 440, 461, 468, 488, 497, 547, 554, 588, 592, 596. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · iber-fl — Estudios cariolgicos en vegetales nemorales del CW espaol. II Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Stud. Bot. Univ. Salamanca6: 159-162(1987).
CCDB · iber-fl — Sobre a cariologia de algumas plantas da Serra do Geres. Fernandes, A.Agron. Lusit.12(4): 551-600(1950).
CCDB · fl-europaea — Suomalainen, 1947
CCDB · poland — Skali?ska M., Pogan E. et al. 1971 a. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov. Ser. Bot. 14, 199-211.
CCDB · book-ipcn65 — Su. Inoue 1965
CCDB · book-ipcn65 — Su, Inoue 1965
CCDB · ipcn-api-dl — Elena Rosselló, J. A., M. A. G. Zapatero & F. N. Andrés. 1987. Estudios cariológicos en vegetales nemorales del CW Español, II. Stud. Bot. Univ. Salamanca 6: 159–162.
CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Scrugli, A. 1982. Numeri cromosomici per la Flora Italiana: 868-872. Inform. Bot. Ital. 14: 229–233.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Wang, J. w., M. x. Li & L. x. Li. 1987. Studies on the cytotaxonomy of Polygonatum. I. Karyotypes and evolution of eight species of Polygonatum in China. J. Wuhan Bot. Res. 5: 1–10.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Malakhova, L. A. & D. V. Fartdinova. 1992. Studies on triploid form Polygonatum humile from the population of Tomsk region. Pp. 34–35 <in> Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Shang, Z. y., R. j. Li & T. c. Cui. 1992. Report on karyotypes of 10 species of Liliaceae (s.l.) from Qinling Range. Acta Phytotax. Sin. 30(5): 438–449.
CCDB · ipcn-api-dl — Sha, W., L. h. Wang, X. j. Yang, X. l. Qi, G. h. Ma & D. y. Zhao. 1995. Chromosome numbers of 20 species from northeast China. J. Wuhan Bot. Res. 32(2): 180–182.
CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Kirschner, J. & J. `tĕpánek. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Fan, X. f., X. q. Guo & S. w. Li. 2000. The studies on the karyotype diversity of 4 species of Liliaceae in Ziwu Mountain. Acta Bot. Boreal.-Occid. Sin. 20(5): 882–888.
CCDB · ipcn-api-dl — Abramova, L. I. 1981. Metodicheskie Ukazaniya po Tsitologicheskoy: Tsitoembriologicheskoy Tekhnike. Nauka, Leningrad.
CCDB · ipcn-api-dl — Krasnoborov, I. M., T. S. Rostovtseva & S. A. Ligus. 1980. Chromosome numbers of some plant species of South Siberia and the Far East. Bot. Zhurn. 65 (5): 659–668.
CCDB · ipcn-api-dl — Wu, S., J. Yang & G. Rao. 2001. Systematic position of Polygonatum simizui (Convallariaceae) based on morphological, cytological and chloroplast DNA sequence data. Bot. J. Linn. Soc. 137(3): 291–296.
CCDB · ipcn-api-dl — Baltisberger, M., D. Dähler & S. Horat. 2002. Karyologische Untersuchungen an den schweizerischen Arten der Gattung Polygonatum. Bot. Helv. 112(2): 91–101.
CCDB · ipcn-api-dl — Weiss-Schneeweiss, H. & C. G. Jang. 2003. Cytotaxonomic analysis of Austrian Polygonatum species (Ruscaceae). Neilreichia 2–3: 245–250.
+58 more references
2n 188×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew +1
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Liu, C. l. & C. j. Ge. 1988. A study on the cytology of Polygonatum odoratum (Mill.) Druce. J. Yantai Norm. Coll., Nat. Sci. 4: 41–44.
CCDB · ipcn-api-dl — Wu, S., J. Yang & G. Rao. 2001. Systematic position of Polygonatum simizui (Convallariaceae) based on morphological, cytological and chloroplast DNA sequence data. Bot. J. Linn. Soc. 137(3): 291–296.
CCDB · ipcn-api-dl — Shao, J. z., D. c. Zhang & F. Qian. 1994. Studies on cytotaxonomy of Polygonatum from Anhui. Guihaia 14(4): 361–368.
CCDB · ipcn-api-dl — Han, M. K., C. G. Jang, B. u. Oh & Y. s. Kim. 1998. A cytotaxonomic study of genus Polygonatum in Korea. Korean J. Pl. Taxon. 28: 187–208.
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · CromoCat 2015 — Shao, J.-Z., D.-C. Zhang, J.-G. Yang, C.-H. Yao & F. Qian. (1993). Karyotype analysis of 5 species of Polygonatum Mill. Acta Phytotax. Sin. 31:353-361
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
2n 305×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ipcn-api-dl · CCDB · book-northern-plants +1
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Amelchenko. 2005. New taxa of the genus Polygonatum (Convallariaceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 90(5): 749–752.
CCDB · book-northern-plants — Maude I939, I940.
CCDB · CromoCat 2015 — Malakhova, L. A. & Markova, G. A. (1994). Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones Bot. Žurn. 79(7): 134-135
2n 222×CCDB · book-ipcn66 · CCDB · CromoCat 2015
CCDB · book-ipcn66 — Jinno 1966
CCDB · CromoCat 2015 — Fang, Y.-x. (1989). The karyotype of Polygonatum odoratum (Mill.) Druce. Pp. 261–265 in D. Hong (editor), Plant Chromosome Research 1987
2n 242×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Wang, J. w., M. x. Li & J. Yang. 1991. Variation and phylogenetic relationships between Polygonatum odoratum and P. cyrtonema. Acta Phytotax. Sin. 29(6): 511–516.
CCDB · CromoCat 2015 — Wang, J. -W., M. -X. Li & J. Yang. (1991). Variation and phylogenetic relationships between Polygonatum odoratum and P. cyrtonema. Acta Phytotax. Sin. 29(6):511-516
2n 262×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
2n 292×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
2n 402×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ma, X. h., X. q. Ma & N. Li. 1990. Chromosome observation of some drug plants in Xinjiang. Acta Bot. Boreal.-Occid. Sin. 10: 203–210.
CCDB · CromoCat 2015 — Ma, X.-h., Ma, X.-q. & Li, N. (1990). Chromosome observation of some drug plants in Xinjiang. Acta Botanica Boreali-Occidentalia Sinica 10: 203-210
2n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Shao, J.-Z., D.-C. Zhang, J.-G. Yang, C.-H. Yao & F. Qian. (1993). Karyotype analysis of 5 species of Polygonatum Mill. Acta Phytotax. Sin. 31:353-361
2n 281×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
n 102×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · CromoCat 2015 — Cauderon, Y. (1958). Étude cytogénétique des Agropyrum français et de leurs hybrides avec les blés. Ann. Inst. Natl. Rech. Agron., Ser. B. 8: 389-543.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.998 ↗
07Deep time~0.95 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.95 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type140 596 records
Wild obs. + sensor126 853
Museum / vouchered10 972
Cultivated / captive54
Other2 717
Origin
Native684
Introduced66
Range
Area of Occupancy AOO176 492 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 31 535≤1 km 15 742≤10 km 51 041>10 km 1 500
99 818 georeferenced · 27 035 without coordinates
Open the mapobservation + sensor126 853
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 693≤1 km 1 974≤10 km 3 392>10 km 869
6 928 georeferenced · 4 044 without coordinates
Open the institutions mapphysical evidence10 972
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 2≤10 km 15>10 km 8
25 georeferenced · 29 without coordinates
Open the mapnot free-living54
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions103 of 229 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 174 |
| Helsinki, FI | 649 |
| Olocation not on record | 521 |
| Moscow State Universitylocation not on record | 453 |
| Yangling, CN | 337 |
| LDlocation not on record | 293 |
| BFLlocation not on record | 290 |
| Kuopio, FI | 254 |
| BIO-UNIPIlocation not on record | 220 |
| Beijing, CN | 203 |
| Trondheim, NO | 202 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 159 |
| MeiseBGlocation not on record | 158 |
| Turku, FI | 155 |
| Oskarshamn, SE | 132 |
| Irkutsk State Universitylocation not on record | 128 |
| KMNlocation not on record | 119 |
| Bergen, NO | 117 |
| Salzburg, AT | 114 |
| MAlocation not on record | 109 |
| SLU Artdatabankenlocation not on record | 106 |
| Oulu, FI | 104 |
| Tartu, EE | 99 |
| Dresden, DE | 84 |
| KR | 84 |
| València, ES | 67 |
| BDBClocation not on record | 67 |
| Uppsala, SE | 63 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 62 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 61 |
| Jyväskylä, FI | 55 |
| Lanzhou, CN | 54 |
| Entomological Society of Latvialocation not on record | 50 |
| SXTCMlocation not on record | 48 |
| Barcelona, ES | 46 |
| Uniwersytet Warszawskilocation not on record | 42 |
| Zürich, CH | 41 |
| Adam Mickiewicz University in Poznańlocation not on record | 36 |
| Tallinn, EE | 36 |
| Salamanca, ES | 31 |
| CICYTEXlocation not on record | 31 |
| Kunming, CN | 30 |
| Chengdu, CN | 30 |
| Vitoria, ES | 27 |
| Zhengzhou, CN | 27 |
| Bern, CH | 26 |
| Görlitz, DE | 26 |
| Guangzhou, CN | 26 |
| Nanjing, CN | 24 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| BRNUlocation not on record | 24 |
| ISAlocation not on record | 22 |
| Wuhan, CN | 21 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 21 |
| Xining, CN | 20 |
| SWlocation not on record | 20 |
| TUR-Alocation not on record | 19 |
| Guilin, CN | 19 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 19 |
| TROMlocation not on record | 18 |
| WNNUlocation not on record | 18 |
| Porvoo, FI | 18 |
| Inner Mongolia Universitylocation not on record | 17 |
| Wlocation not on record | 17 |
| DBF-NHMDlocation not on record | 16 |
| Chengdu, CN | 15 |
| Shanghai, CN | 15 |
| Mlocation not on record | 15 |
| Granada, ES | 15 |
| Philadelphia, US | 15 |
| Berlin, DE | 15 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 14 |
| Ischia Marine Centrelocation not on record | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 14 |
| Jiangxi College of Educationlocation not on record | 14 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Kyoto Universitylocation not on record | 14 |
| BClocation not on record | 13 |
| Hebei Normal Universitylocation not on record | 13 |
| Provincia di Livornolocation not on record | 13 |
| CJBGlocation not on record | 11 |
| Zürich, CH | 11 |
| Shanxi Institute of Biologylocation not on record | 11 |
| ENTClocation not on record | 11 |
| LfUlocation not on record | 11 |
| Madrid, ES | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| Saint Louis, US | 10 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Alicante, ES | 8 |
| Porrentruy, CH | 8 |
| Badajoz, ES | 8 |
| Edinburgh, GB | 8 |
| NMBU:MINAlocation not on record | 8 |
| GJOlocation not on record | 7 |
| WTUlocation not on record | 7 |
| GZUlocation not on record | 7 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 7 |
| Podgorica, ME | 6 |
| Kew, GB | 6 |
| Peking Universitylocation not on record | 6 |
| Tsukuba, JP | 6 |
| Frankfurt am Main | 6 |
| PRClocation not on record | 6 |
| South Kensington, GB | 6 |
| nbflocation not on record | 6 |
| Herb. BBGlocation not on record | 5 |
| BGBMlocation not on record | 5 |
| Northeastern Forestry Universitylocation not on record | 5 |
| Glarus, CH | 5 |
| KOMlocation not on record | 5 |
| No collectionlocation not on record | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| Wuhan, CN | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Palacký University in Olomouclocation not on record | 4 |
| Shanxi Universitylocation not on record | 4 |
| Pamplona, ES | 4 |
| Durham, US | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Coimbra, PT | 4 |
| Tula State Universitylocation not on record | 4 |
| UGentlocation not on record | 4 |
| Taipei, TW | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| ifplocation not on record | 4 |
| Paris, FR | 4 |
| Nanchong, CN | 4 |
| NSMKlocation not on record | 4 |
| Changsha, CN | 3 |
| Bourges, FR | 3 |
| Forssa, FI | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Hangzhou, CN | 3 |
| Burlington, US | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Chengdu, CN | 3 |
| Tilburg, NL | 3 |
| IMMUlocation not on record | 3 |
| Xian, CN | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Awka, NG | 3 |
| BMlocation not on record | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| FLADlocation not on record | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| Göteborg, SE | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Karlsruhe, DE | 2 |
| Pamplona, ES | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Namur, BE | 2 |
| Chongqing, CN | 2 |
| PrivatHerblocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Lausanne, CH | 2 |
| SZUlocation not on record | 2 |
| Boise, US | 2 |
| Stockholm, SE | 2 |
| Shenzhen, CN | 1 |
| Brussel, BE | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Guiyang, CN | 1 |
| Beijing, CN | 1 |
| Guangzhou, CN | 1 |
| Banyoles, ES | 1 |
| Zhejiang Universitylocation not on record | 1 |
| SCAUlocation not on record | 1 |
| Toronto, CA | 1 |
| IPE-CSIClocation not on record | 1 |
| Bando, JP | 1 |
| JMSlocation not on record | 1 |
| PVTlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Dekalb, US | 1 |
| Macomb, US | 1 |
| Logan, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| College Park, US | 1 |
| H-Adlerlocation not on record | 1 |
| Bronx, US | 1 |
| Hudson, US | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Vancouver, CA | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Voronezh State Universitylocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| IATMlocation not on record | 1 |
| Bangkok, TH | 1 |
| Monastir, TN | 1 |
| Shanghai, CN | 1 |
| Kagoshima, JP | 1 |
| Auckland, NZ | 1 |
| Xiamen, CN | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Odawara, JP | 1 |
| Bloomington, US | 1 |
| Córdoba, ES | 1 |
| Oswego, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| sxphclocation not on record | 1 |
229 institutions · 10 280 of 10 972 vouchered records shown · 597 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Polygonatum odoratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.4 °C 12.0–15.7
Seasonal swing summer↔winter13.4 °C
Max temp (day)15.7 °C 14.2–18.3
Min temp (night)9.20 °C 8.60–13.1
Precipitation72.6 mm/mo 60.8–102
Air humidity62.6 % 61.7–66.5
Moisture balance-19.2 mm/mo
Vapour deficit531 Pa 489–669
Wind speed5.40 m/s
Cloud cover39.1 % 34.9–46.0
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.