Polygonatum multiflorum
(L.) All. · speciesAt a glance
Occurrence records312 739
Data sources13
Biological traits47
DNA specimens23
eDNA detections16
Sources13 archives
Databases and archives Polygonatum multiflorum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility312 739 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS10 compounds
Occurrence & distributionGBIF312 739 records
Environmental DNA1 datasets · 3 countries16 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB · GoaT10.7 Gbp
01Narrative
Le Sceau-de-Salomon multiflore est une espèce de plantes herbacées vivace, rhizomateuse, de la famille des Asparagacées. La Classification de Cronquist la classait parmi les Convallariacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology11
Fruit width9.3 mm
Leaf mass48.35 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 2 038 mm² · GIFT: 2 038 mm²
Plant height0.445 m
⚠ sources differ — GIFT: 0.445 m · LEDA: 0.445 m · TRY: 0.12 m
Plant height generative0.3 m
Plant height max0.8 m
Plant height min0.3 m
Seed length3.55 mm
Seed mass25.75 mg
⚠ sources differ — TRY: 25.75 mg · LEDA: 23.85 mg · GIFT: 60.22 mg
Seed mass max28.6 mg
Seed mass min23.85 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formrhizomatous geophyte
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number49
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min1 800 m
Epiphyteterrestrial
Fruit typeberry
Growth formherb
Habitat GIFTforest, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio18.2 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)150 mg/g
Leaf n24.01 mg/g
Leaf p2.1 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)43.73 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition10 compounds
Compounds documented for Polygonatum multiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Flavonols6
Flavones2
Aminoacids1
Oleanane triterpenoids1
Documented compounds10 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (s)-Azetidine-2-carboxylate | present | LOTUS | |
| 2-[3,4-dihydroxy-5-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | NPASS | |
| 2-[3,4-dihydroxy-5-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | NPASS | |
| Hyperin | present | NPASS | |
| Kaempferol | present | NPASS | |
| Myricetin | present | NPASS | |
| Quercetin 4'-O-galactoside | present | NPASS | |
| Saponoside A | present | LOTUS | |
| Vicenin 3 | present | LOTUS | |
| Vitexin | present | LOTUS |
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonatum multiflorum has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes5
GenBank sequences10
eDNA detections16
Countries5
The DNA barcodea real sequence read deposited for this species
GCGGGGGGCGGAGGGAGGGCGGACGTTCCGGCCGCCCGAACCCCGCCACCCCGGGGCCCCAATGGCGCCCCCGCCCCGCCTCGCTGCGGG …
Polygonatum multiflorum voucher DNA3706 TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL7★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Polygonatum multiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size10 748 220 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Polygonatum multiflorum10.75 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode40records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1822×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Skali?ska M., Pogan E. et al. 1971 a. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov. Ser. Bot. 14, 199-211.
CCDB · ipcn-api-dl — Abramova, L. I. 1990. Caryological study of the polypoid species of Polygonatum (Convallariaceae) from the Soviet Union. Bot. Žhurn. (Moscow & Leningrad) 75: 652–658.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Tamura, M. N. 1993. Biosystematic studies on the genus Polygonatum (Liliaceae) III. Morphology of staminal filaments and karyology of eleven Eurasian species. Bot. Jahrb. Syst. 115(1): 1–26.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Baltisberger, M., D. Dähler & S. Horat. 2002. Karyologische Untersuchungen an den schweizerischen Arten der Gattung Polygonatum. Bot. Helv. 112(2): 91–101.
CCDB · book-ipcn72 — NOWAKOWSKA, T., & B. ZEGLICKA. 1972. Karyological studies in Polygonatum Mill. I. Karyotype analysis of P. multiflorum CL.) All. and P. odoratum (Mill.) Druce. - Acta Biol-:- Cracov. Ser. Bot. 15: 77-86.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — ABRAMOVA, L.J. A karyosystematic survey of the species of Polygonatum Mill. indigenous to the U.S.S.R. (in Russian) Bot. Zurn. 56: 530-543.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn67-71 — SKALINSKA, M. E. POGAL ET AL. 1971. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov., Ser. Bot. 14: 198-213.
CCDB · book-northern-plants — Junell (L. & L. I942 b).
CCDB · book-indian_vol2 — Berg, K.H. von 1933 ; Tischler, G. 1934 ; Polya, L. 1950 ; Therman, E. 1953a (Love, A. & LHve, D. 1961b) ; Gadella, T.W.J. & Kliphuis, E. 1963, 1966; Zhukova, P.G. 1967b ; Majovsky, J. et al. 1970b ; Abramova, L.J. 1971 ; Lovka, M. et al. 1971 ; Skalinska, M. & Pogan, E. 1971 ; Nowakowska, T. & Zeglicka, B. 1972
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.
2n 205×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · book-ipcn73-74 +2
CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).
CCDB · book-ipcn65 — Abramova 1965
CCDB · book-ipcn73-74 — SCHOTSMAN, H.D. 1970. Contribution a la caryologie des angiospermes de la Sologne et du Val de Loire. II. Bull. Centr. Etudes Rech. Sci. 8: 199-255.
CCDB · book-indian_vol2 — Sorsa, V. 1963b ; Abramova, L.I. 1965
CCDB · CromoCat 2015 — Popova, M. (1973a). Kariologicno proucvane v rod Polygonatum Adans. Naucni Trudove (Plovdiv) 22(1): 63 -68.
2n 284×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Abramova, L.I.-1970
CCDB · CromoCat 2015 — Abramova, L. I. (1990). Caryological study of the polypoid species of Polygonatum (Convallariaceae) from the Soviet Union Bot. Žhurn. (Moscow & Leningrad) 75: 652–658
CCDB · CromoCat 2015 — Pandita, T. K. (1979). Cytological investigations of some monocots of Kashmir. Ph.D. Thesis, Chandigarh 1979.
CCDB · CromoCat 2015 — Pandita, T.K. & Mehra., P.N. (1982). Karyotype analysis of five taxa of Polygonatum. Proc. Indian Acad. Sci., B 48: 255–263.
2n 223×CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-indian_vol2 — Mehra, P.N. & Pathania, R.S. 1960b ; Kumar, V. 1968 : Mehra, P.N. & Sachdeva, S.K. 1976e ; Mehra, P.N. & Pandita, T.K. 1978
CCDB · CromoCat 2015 — Mehra, P. N. & T. K. Pandita. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 387-388.
2n 303×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · book-northern-plants
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · book-northern-plants — Dark (M. I939).
2n 241×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Bl)nicke, L. 1911
2n 291×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Abramova, L. I. (1990). Caryological study of the polypoid species of Polygonatum (Convallariaceae) from the Soviet Union Bot. Žhurn. (Moscow & Leningrad) 75: 652–658
2n 321×CCDB · fl-europaea
CCDB · fl-europaea — Sorsa, 1963
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
n 101×CCDB · Cave1963
CCDB · Cave1963 — Sorsa 1963c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.990 ↗
08Occurrence & distribution
Record type312 739 records
Wild obs. + sensor298 744
Museum / vouchered11 139
Cultivated / captive261
Other2 595
Origin
Native1 472
Introduced841
Range
Area of Occupancy AOO288 920 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy34% within 1 km
≤100 m 37 582≤1 km 44 454≤10 km 155 722>10 km 2 405
240 163 georeferenced · 58 581 without coordinates
Open the mapobservation + sensor298 744
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤100 m 485≤1 km 2 077≤10 km 5 371>10 km 451
8 384 georeferenced · 2 755 without coordinates
Open the institutions mapphysical evidence11 139
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 14>10 km 11
25 georeferenced · 236 without coordinates
Open the mapnot free-living261
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions69 of 154 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 298 |
| Helsinki, FI | 345 |
| Olocation not on record | 327 |
| LDlocation not on record | 326 |
| BFLlocation not on record | 317 |
| BIO-UNIPIlocation not on record | 283 |
| MeiseBGlocation not on record | 258 |
| Moscow State Universitylocation not on record | 222 |
| Salzburg, AT | 147 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 121 |
| Oskarshamn, SE | 115 |
| Turku, FI | 88 |
| Uppsala, SE | 81 |
| Provincia di Livornolocation not on record | 73 |
| Adam Mickiewicz University in Poznańlocation not on record | 69 |
| Tartu, EE | 62 |
| SLU Artdatabankenlocation not on record | 58 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 56 |
| BRNUlocation not on record | 52 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 44 |
| Görlitz, DE | 42 |
| KMNlocation not on record | 40 |
| DBF-NHMDlocation not on record | 39 |
| Tallinn, EE | 36 |
| Trondheim, NO | 33 |
| Philadelphia, US | 32 |
| Oulu, FI | 31 |
| Karlsruhe, DE | 30 |
| Dresden, DE | 28 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| MAlocation not on record | 25 |
| Voronezh State Universitylocation not on record | 23 |
| LfUlocation not on record | 23 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| South Kensington, GB | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| Palacký University in Olomouclocation not on record | 19 |
| Bern, CH | 18 |
| Bergen, NO | 18 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 18 |
| Vitoria, ES | 16 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Berlin, DE | 15 |
| Kuopio, FI | 15 |
| TUR-Alocation not on record | 14 |
| Wlocation not on record | 14 |
| Tula State Universitylocation not on record | 13 |
| Uniwersytet Warszawskilocation not on record | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Jyväskylä, FI | 12 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Zürich, CH | 10 |
| Wellington, NZ | 10 |
| BDBClocation not on record | 10 |
| Frankfurt am Main | 10 |
| PRClocation not on record | 9 |
| TROMlocation not on record | 9 |
| Mlocation not on record | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Hobart, AU | 8 |
| Winterthur, CH | 8 |
| Porvoo, FI | 7 |
| Université Lavallocation not on record | 7 |
| Porrentruy, CH | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Tilburg, NL | 6 |
| Guangzhou, CN | 6 |
| GZUlocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 6 |
| Nanjing, CN | 5 |
| Salamanca, ES | 5 |
| Québec, CA | 5 |
| H-Resselocation not on record | 4 |
| Paris, FR | 4 |
| Podgorica, ME | 4 |
| València, ES | 4 |
| Glarus, CH | 4 |
| PrivatHerblocation not on record | 4 |
| Montréal, CA | 4 |
| GJOlocation not on record | 4 |
| GMBAlocation not on record | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Barcelona, ES | 4 |
| NMBU:MINAlocation not on record | 4 |
| Stockholm, SE | 4 |
| FJIDClocation not on record | 3 |
| Auckland, NZ | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Bourges, FR | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Saint Louis, US | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| SZUlocation not on record | 3 |
| nbflocation not on record | 3 |
| BClocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Xian, CN | 2 |
| Wuhan, CN | 2 |
| Beijing, CN | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Taipei, TW | 2 |
| Shanghai, CN | 2 |
| Namur, BE | 2 |
| National Museum Waleslocation not on record | 2 |
| Zürich, CH | 2 |
| BSBIlocation not on record | 2 |
| Institute of Botany, Ilia State Universitylocation not on record | 2 |
| Kew, GB | 2 |
| Kathmandu, NP | 2 |
| CJBGlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Pamplona, ES | 1 |
| PUC-RSlocation not on record | 1 |
| Gijón, ES | 1 |
| Durham, US | 1 |
| Logan, US | 1 |
| Ivano-Frankove, UA | 1 |
| Chongqing Museumlocation not on record | 1 |
| Plocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Christchurch, NZ | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| HUN003location not on record | 1 |
| Sevilla, ES | 1 |
| Tromso University Museumlocation not on record | 1 |
| New Haven, US | 1 |
| Rotorua, NZ | 1 |
| UoB-IBlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Flagstaff, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Xiamen, CN | 1 |
| IPE-CSIClocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| FLADlocation not on record | 1 |
| Canberra, AU | 1 |
| Tampa, US | 1 |
| nlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Shanghai, CN | 1 |
| Fort Worth, US | 1 |
| BGBMlocation not on record | 1 |
154 institutions · 10 358 of 11 139 vouchered records shown · 632 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Polygonatum multiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map3 countries0
Echappe de culture le long de lat cloture de…ash forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.0 °C 5.40–17.4
Seasonal swing summer↔winter13.6 °C
Max temp (day)13.9 °C 6.80–20.2
Min temp (night)7.40 °C 1.80–14.0
Precipitation80.2 mm/mo 56.0–104
Air humidity62.1 % 61.2–64.5
Moisture balance-21.9 mm/mo -52.6–34.2
Vapour deficit470 Pa 332–742
Wind speed4.20 m/s 3.10–4.50
Cloud cover42.6 % 37.7–57.5
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.