Polygala vulgaris
speciesAt a glance
Occurrence records226 125
Data sources12
Biological traits51
DNA specimens37
eDNA detections22
Sources12 archives
Databases and archives Polygala vulgaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility226 125 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources51 traits
Chemical compositionLOTUS5 compounds
Occurrence & distributionGBIF226 125 records
Environmental DNA1 datasets · 6 countries22 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT978 Mbp
01Narrative
Polygala vulgaris, le Polygale commun, est une espèce de plante à fleurs de la famille des Polygalacées, genre Polygala. C'est une plante herbacée originaire d'Europe, en incluant la Russie européenne, et de Turquie. Elle a été introduite aux États-Unis.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology15
Fruit length9 mm
Fruit width7 mm
Leaf length19 mm
Leaf length max12 mm
Leaf mass2.15 mg
Leaf size27.44 mm²
⚠ sources differ — TRY: 27.44 mm² · LEDA: 55 mm² · GIFT: 53.54 mm²
Leaf width4 mm
Plant height0.084 m
⚠ sources differ — GIFT: 0.084 m · AusTraits: 0.4 m · LEDA: 0.04 m · TRY: 0.116 m
Plant height generative0.06 m
Plant height max0.4 m
Plant height min0.05 m
Seed length2.61 mm
⚠ sources differ — TRY: 2.61 mm · AusTraits: 2.25 mm
Seed mass1.81 mg
⚠ sources differ — TRY: 1.81 mg · LEDA: 1.72 mg · GIFT: 1.77 mg
Seed mass max1.96 mg
Seed mass min1.6 mg
Life cycle & reproduction14
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number23
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTmeadows
Leaf compoundnesssimple
Leaf shapeelliptical lanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c496 mg/g
Leaf dry-matter content (LDMC)265 mg/g
⚠ sources differ — TRY: 265 mg/g · LEDA: 235 mg/g
Leaf n29 mg/g
Leaf p2.5 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.41 mm²/mg
⚠ sources differ — TRY: 21.41 mm²/mg · LEDA: 16.3 mm²/mg · GIFT: 18.39 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition5 compounds
Compounds documented for Polygala vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Plant xanthones2
Cinnamic acids and derivatives2
p-Terphenyls1
Documented compounds5 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 4-(3,5-Dimethoxyphenyl)phenol | present | LOTUS | |
| 7-Chloro-1,2,3-trihydroxy-6-methoxyxanthen-9-one | present | LOTUS | |
| 9H-Xanthen-9-one, 1,3-dihydroxy-2,4,7-trimethoxy- | present | LOTUS | |
| Antithiamine factor | present | LOTUS | |
| Methyl 3-(4-hydroxy-3,5-dimethoxyphenyl)prop-2-enoate | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala vulgaris has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes8
GenBank sequences10
eDNA detections22
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTTTGGTTGAGGGCACGTCTGCTTGGGTGTCACGCATCGTCGCCTTCCT …
Polygala vulgaris subsp. vulgaris voucher PLT.0654 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Polygala vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size978 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Polygala vulgaris0.98 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidypolyploid inferred
Chromosome records24–682n range52median68mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 689×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · fl-europaea +3
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Glendinning, D.R. Nature 188: 604-605 (1960)
CCDB · fl-europaea — Glendinning, 1960
CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1987. Karyological study of the Slovak flora XIX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 3–20.
CCDB · book-fedorov — Glendinning 1960
CCDB · CromoCat 2015 — Verlaque, R., M. Seidenbinder & P. Donadille. (1987b). Recherches cytotaxonomiques sur la spéciation en région méditerranéenne. III: Espèces aneuploides. Rev. Biol.-Écol. Méd. 10(4): 315-346.
CCDB · CromoCat 2015 — Glendinning, D. R. (1960). Cytology of Polygala. Nature 188(4750): 604-605.
CCDB · CromoCat 2015 — Heubl, G. R. (1984). Systematische untersuchungen an mitteleuropäischen Polygala arten. Mitt. Bot. Staatssamml. München 20: 205-428.
2n 344×CCDB · poland · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
CCDB · CromoCat 2015 — Pogan, E. , Rychlewski J. , (et Ai. ). (1980). Further studies in chromosome numbers of Polish Angiosperms. Acta Biologica Cracoviensia, Series Botanica 22: 129-153.
2n 283×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Mattick, 1950
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
CCDB · CromoCat 2015 — Wulff, H. D. (1938). Chromosomenstudien an der schleswig-holsteinischen Angiospermen-Flora. II. Ber. Deutsch. Bot. Ges. 56: 247-254.
2n 322×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Mattick, 1950
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 562×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · CromoCat 2015 — Wulff, H. D. (1938). Chromosomenstudien an der schleswig-holsteinischen Angiospermen-Flora. II. Ber. Deutsch. Bot. Ges. 56: 247-254.
2n 241×CCDB · book-fedorov
CCDB · book-fedorov — Lewis W. H., Davis 1962
2n 481×CCDB · fl-europaea
CCDB · fl-europaea — Wulff, 1938
n 343×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. & J. Mĕsíček. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type226 125 records
Wild obs. + sensor212 513
Museum / vouchered12 508
Cultivated / captive28
Other1 076
Origin
Native15 925
Introduced26
Range
Area of Occupancy AOO264 464 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 43 164≤1 km 36 754≤10 km 97 117>10 km 852
177 887 georeferenced · 34 626 without coordinates
Open the mapobservation + sensor212 513
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 1 552≤1 km 3 263≤10 km 3 595>10 km 763
9 173 georeferenced · 3 335 without coordinates
Open the institutions mapphysical evidence12 508
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 17
17 georeferenced · 11 without coordinates
Open the mapnot free-living28
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions89 of 179 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 435 |
| Olocation not on record | 1 044 |
| LDlocation not on record | 754 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 670 |
| Helsinki, FI | 453 |
| MeiseBGlocation not on record | 375 |
| Trondheim, NO | 353 |
| Bergen, NO | 314 |
| KMNlocation not on record | 311 |
| Oskarshamn, SE | 284 |
| Brussel, BE | 193 |
| Moscow State Universitylocation not on record | 173 |
| BFLlocation not on record | 171 |
| SLU Artdatabankenlocation not on record | 167 |
| Adam Mickiewicz University in Poznańlocation not on record | 140 |
| Turku, FI | 139 |
| Entomological Society of Latvialocation not on record | 125 |
| MAlocation not on record | 125 |
| BRNUlocation not on record | 115 |
| GJOlocation not on record | 113 |
| South Kensington, GB | 111 |
| Vitoria, ES | 106 |
| Barcelona, ES | 98 |
| TROMlocation not on record | 94 |
| Salzburg, AT | 85 |
| Uppsala, SE | 82 |
| Tartu, EE | 77 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 69 |
| TUR-Alocation not on record | 65 |
| València, ES | 59 |
| Provincia di Livornolocation not on record | 50 |
| BDBClocation not on record | 50 |
| Kuopio, FI | 49 |
| Oulu, FI | 48 |
| DBF-NHMDlocation not on record | 46 |
| BClocation not on record | 45 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 41 |
| ISAlocation not on record | 41 |
| Pamplona, ES | 40 |
| Philadelphia, US | 38 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 37 |
| Salamanca, ES | 33 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 31 |
| Berlin, DE | 29 |
| PRClocation not on record | 29 |
| Porrentruy, CH | 27 |
| Uniwersytet Jagiellońskilocation not on record | 25 |
| Görlitz, DE | 25 |
| BIO-UNIPIlocation not on record | 23 |
| CICYTEXlocation not on record | 23 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 22 |
| Jyväskylä, FI | 21 |
| Wlocation not on record | 19 |
| Madrid, ES | 18 |
| Natural History Museum Rotterdamlocation not on record | 18 |
| Pamplona, ES | 17 |
| Christchurch, NZ | 17 |
| Podgorica, ME | 16 |
| Frankfurt am Main | 15 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Dresden, DE | 13 |
| Granada, ES | 12 |
| Museo Entomologico de Leonlocation not on record | 12 |
| Stockholm, SE | 11 |
| Tallinn, EE | 10 |
| Porvoo, FI | 10 |
| Bourges, FR | 10 |
| Museo Achille Folettolocation not on record | 10 |
| Wellington, NZ | 9 |
| Canberra, AU | 9 |
| Glarus, CH | 8 |
| Alicante, ES | 8 |
| Fulda, DE | 8 |
| Wuzhou, CN | 8 |
| NMBU:MINAlocation not on record | 8 |
| nbflocation not on record | 8 |
| Mlocation not on record | 7 |
| Winterthur, CH | 7 |
| Tilburg, NL | 6 |
| Badajoz, ES | 6 |
| Hobart, AU | 6 |
| Voronezh State Universitylocation not on record | 6 |
| GZUlocation not on record | 6 |
| Auckland, NZ | 6 |
| Corvallis, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| LfUlocation not on record | 5 |
| QVMAGlocation not on record | 5 |
| Naturalis Biodiversity Centerlocation not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| BSBIlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| CJBNlocation not on record | 4 |
| Dhaka, BD | 4 |
| UGentlocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| FLADlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Göteborg, SE | 3 |
| Sion, CH | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Paris, FR | 3 |
| Durham, US | 3 |
| Chongqing Museumlocation not on record | 3 |
| OLAlocation not on record | 3 |
| Banyoles, ES | 3 |
| Monastir, TN | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Bloomington, US | 3 |
| IB FRC Komi SC UB RASlocation not on record | 3 |
| Edinburgh, GB | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Saint Louis, US | 2 |
| Palmerston North, NZ | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| San Francisco, US | 2 |
| JBSlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| SWlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Zürich, CH | 2 |
| ULBF-AGRlocation not on record | 2 |
| UIBlocation not on record | 2 |
| Boise, US | 2 |
| WTUlocation not on record | 2 |
| Coimbra, PT | 2 |
| Vancouver, CA | 2 |
| Boumlocation not on record | 2 |
| Cheney, US | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Xiamen, CN | 2 |
| BioFokuslocation not on record | 2 |
| Ann Arbor, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Ivano-Frankove, UA | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Frauenfeld, CH | 1 |
| Dekalb, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Zürich, CH | 1 |
| Columbia, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| MHNAIXlocation not on record | 1 |
| Fribourg, CH | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Namur, BE | 1 |
| Nijmegen, NL | 1 |
| UoB-IBlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Beijing, CN | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Rotorua, NZ | 1 |
| IPE-CSIClocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Taipei, TW | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| Salvador, BR | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Clemson, US | 1 |
| Victoria, CA | 1 |
| EL PASO, US | 1 |
| Portland, US | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Davenport, US | 1 |
| Tuscaloosa, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Moscow, US | 1 |
| NoColllocation not on record | 1 |
| Kew, GB | 1 |
| Mount Annan, AU | 1 |
| Jaén, ES | 1 |
179 institutions · 11 608 of 12 508 vouchered records shown · 825 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Polygala vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map6 countries0
chalk meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 7.00–15.9
Seasonal swing summer↔winter13.9 °C
Max temp (day)15.5 °C 11.2–19.2
Min temp (night)11.2 °C 2.10–13.5
Precipitation78.7 mm/mo 53.5–170
Air humidity63.2 % 61.1–65.9
Moisture balance-41.1 mm/mo -70.4–109
Vapour deficit573 Pa 402–693
Wind speed4.50 m/s 2.70–6.30
Cloud cover48.8 % 37.8–55.7
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.