Polygala virgata

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records1 613

Data sources10

Biological traits44

DNA specimens6

eDNA detections5

Sources10 archives

Databases and archives Polygala virgata's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 613 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF1 613 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 38

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length10 mm

Fruit width8 mm

Leaf length12.5 mm

Leaf length max50 mm

Leaf length min10 mm

Leaf width1.75 mm

Leaf width max5 mm

Leaf width min1 mm

Plant height2.5 m

⚠ sources differ — AusTraits: 2.5 m · TRY: 1.5 m

Plant height max3 m

Plant height min1 m

Seed length2.5 mm

Seed mass6.4 mg

Seed mass max6.42 mg

Seed mass min6.37 mg

Life cycle & reproduction14

Dehiscencedehiscent

Dispersal typeunspecialized

Flowering endNov

Flowering startJul

Flowering timennnnnnyyyyyn

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 135 m

Elevation min5 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelinear obovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition29 compounds

Compounds documented for Polygala virgata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Plant xanthones17

Cinnamic acids and derivatives3

Isoflavones3

Prenyl quinone meroterpenoids1

Acyl phloroglucinols $ Prenylated,geranylated phloroglucinols1

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5,10-dihydroxy-2-(2-hydroxypropan-2-yl)-1,2-dihydrofuro[2,3-c]xanthen-6-one	present	NPASS
(2R)-5,9-dihydroxy-10-methoxy-1,1,2-trimethyl-2H-furo[2,3-c]xanthen-6-one	present	NPASS
(2S)-2,8-dimethyl-2-[(3E,7E)-4,8,12-trimethyltrideca-3,7,11-trienyl]chroman-6-ol	present	NPASS
(2S)-5,10-dihydroxy-1,1,2-trimethyl-2H-furo[2,3-c]xanthen-6-one	present	NPASS
1,2,3,4,6,7-Hexamethoxyxanthon	present	LOTUS
1,3,6-Trihydroxy-5-methoxy-4-(2-methylbut-3-en-2-yl)xanthen-9-one	present	NPASS
1,7-Dihydroxy-2,3,4-trimethoxy-9H-xanthen-9-one	present	LOTUS
3',6-Disinapoylsucrose	present	LOTUS
4-Geranyloxy-2,6-Dihydroxybenzophenone	present	NPASS
5,7-Dihydroxy-3-(4-hydroxyphenyl)-6,8-dimethoxychromen-4-one	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala virgata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR392105.1 ↗598 bp

ACGT

TCGAACCTACTCGNAGAGCGACCGTTGGACACGTATATCTTCACGGCGGGCGGATGGGCGCATGCGCTGCGCCCGTCCCCCGCCCTCGAG …

Polygala virgata voucher Zhigila, Schmiedel & Muasya 1240 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Polygala virgata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · Cave1959

CCDB · Cave1959 — Larsen 1959b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.583 ↗

08Occurrence & distribution

Record type1 613 records

Wild obs. + sensor1 340

Museum / vouchered265

Cultivated / captive5

Other3

Origin

Introduced193

Range

Area of Occupancy AOO3 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 807≤1 km 180≤10 km 70>10 km 49

1 106 georeferenced · 234 without coordinates

Open the mapobservation + sensor1 340

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 74≤1 km 34≤10 km 57>10 km 12

177 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence265

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	52
Mount Annan, AU	33
Canberra, AU	23
Auckland, NZ	20
Adelaide, AU	20
Museo Entomologico de Leonlocation not on record	16
Kensington, AU	8
Armidale, AU	7
Philadelphia, US	7
Adam Mickiewicz University in Poznańlocation not on record	6
Batemans Bay, AU	6
Saint Louis, US	6
Kew, GB	5
Christchurch, NZ	4
MeiseBGlocation not on record	4
Hobart, AU	3
John T. Waterhouse Herbariumlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Moscow State Universitylocation not on record	2
Wollongong, AU	2
Wellington, NZ	2
University of Stellenboschlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Plocation not on record	2
Cape Town, ZA	1
Bronx, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
University of Johannesburglocation not on record	1
WAGlocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
Görlitz, DE	1
Stockholm, SE	1
Pretoria, ZA	1
Royal Botanic Gardens, Kewlocation not on record	1

34 institutions · 248 of 265 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Polygala virgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 16.5–18.8

Seasonal swing summer↔winter8.10 °C

Max temp (day)22.3 °C 22.3–25.3

Min temp (night)11.4 °C 10.9–14.4

Precipitation38.9 mm/mo 16.6–83.4

Air humidity57.9 % 51.1–59.0

Moisture balance-58.0 mm/mo -87.9–-27.4

Vapour deficit858 Pa 769–1,103

Wind speed3.40 m/s 1.80–4.20

Cloud cover14.9 % 12.0–21.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polygala virgata

At a glance

Sources10 archives

Size & morphology15

Life cycle & reproduction14

Diet & foraging1

Habitat & environment13

Physiology & chemistry1

Compound class profile5 classes

Documented compounds29 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 613 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 613 records