Polygala paniculata
speciesAt a glance
Occurrence records4 416
Data sources9
Biological traits37
DNA specimens0
eDNA detections0
Sources9 archives
Databases and archives Polygala paniculata's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 416 records↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources37 traits
Chemical compositionLOTUS8 compounds
Occurrence & distributionGBIF4 416 records
DNA & barcodingNCBIsequences
Genome at a glanceGIFT2n = 52
01Narrative
Polygala quitensis is a species of plant in the family Polygalaceae. It is endemic to Ecuador.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsTRY
Size & morphology13
Fruit length2 mm
Fruit length max3 mm
Fruit length min2 mm
Inflorescence length max200 cm
Leaf length3.5 mm
Leaf length max25 mm
Leaf length min2 mm
Leaf width4 mm
Leaf width max4 mm
Leaf width min1 mm
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.5 m
Plant height max0.5 m
Plant height min0.1 m
Life cycle & reproduction8
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
Flower colourgreen
Flowering timeyyyyyynnnnnn
Life spanannual
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climberself-supporting
Elevation max3 380 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo, Campo Rupestre, Floresta Estacional Semidecidual, Restinga
Leaf compoundnesssimple
Leaf shapenarrowly_elliptical
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody_base · GIFT: non-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)10.02 mm²/mg
Other traits1
Shoot orientationascending
03Chemical composition8 compounds
Compounds documented for Polygala paniculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Simple coumarins5
Pyranocoumarins1
Stigmastane steroids1
Flavonols1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3'-O-acetyl-4'-O-benzoylkhellactone | present | LOTUS | |
| 7-[(2Z)-3,7-dimethylocta-2,6-dienoxy]chromen-2-one | present | LOTUS | |
| Auraptene | present | LOTUS | |
| Minumicrolin | present | LOTUS | |
| Murrangatin | present | LOTUS | |
| Phebalosin | present | LOTUS | |
| Quercetin 3-rutinoside | present | LOTUS | |
| Spinosterol | present | LOTUS |
05DNA & barcoding10 sequences
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala paniculata has left across the world's sequence archives.
At a glance
Marker genes3
GenBank sequences10
Countries3
The DNA barcodea real sequence read deposited for this species
TTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTACTCGAAAGAGCGACCGTTGGA …
Senega paniculata voucher Pastore 5094 (CTBS) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★ITS2
plant barcodefungal barcode
06Genome at a glanceGIFT
The complete instruction manual Polygala paniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidy2× diploid · measured
Chromosome records52–562n range54median52mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 521×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 561×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.414 ↗
08Occurrence & distribution
Record type4 416 records
Wild obs. + sensor342
Museum / vouchered3 998
Cultivated / captive1
Other75
Origin
Native16
Introduced101
Range
Area of Occupancy AOO9 852 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 181≤1 km 15≤10 km 5>10 km 11
212 georeferenced · 130 without coordinates
Open the mapobservation + sensor342
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy68% within 1 km
≤100 m 418≤1 km 82≤10 km 199>10 km 35
734 georeferenced · 3 264 without coordinates
Open the institutions mapphysical evidence3 998
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions95 of 232 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 571 |
| Bronx, US | 180 |
| Durango, MX | 175 |
| National Biodiversity Institute, Costa Ricalocation not on record | 130 |
| Brisbane, AU | 128 |
| University of Stellenboschlocation not on record | 80 |
| Mexico City, MX | 76 |
| JBRJlocation not on record | 70 |
| Taipei, TW | 69 |
| Mexico City, MX | 67 |
| Laboratorio de Ictiologialocation not on record | 66 |
| Université de Strasbourglocation not on record | 63 |
| Antiguo Cuscatlán, SV | 62 |
| Canberra, AU | 55 |
| Kew, GB | 53 |
| Blumenau, BR | 41 |
| Berlin, DE | 37 |
| UNICAMPlocation not on record | 33 |
| UFBAlocation not on record | 31 |
| Cenargenlocation not on record | 31 |
| Austin, US | 30 |
| CEPLAClocation not on record | 29 |
| INMAlocation not on record | 28 |
| Durham, US | 28 |
| Xiamen, CN | 27 |
| Smithfield, AU | 27 |
| UFMGlocation not on record | 27 |
| Taipei, TW | 24 |
| Mount Annan, AU | 22 |
| San José, CR | 22 |
| Universidad de Nariño (UdeNar)location not on record | 22 |
| Feira de Santana, BR | 22 |
| León, NI | 22 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 21 |
| Nishihara, JP | 21 |
| Honolulu, US | 21 |
| UnBlocation not on record | 20 |
| Altos de Pipe, VE | 19 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 18 |
| Paris, FR | 17 |
| Universidade Federale do Rio Grande do Sullocation not on record | 17 |
| Universidad Nacional de Colombia (UNAL)location not on record | 16 |
| Aarhus, DK | 15 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 15 |
| Mérida, MX | 15 |
| MEXUlocation not on record | 14 |
| Odawara, JP | 14 |
| TNMlocation not on record | 13 |
| Departamento de Sistematica e Ecologialocation not on record | 12 |
| Salvador, BR | 12 |
| Auckland, NZ | 11 |
| Austin, US | 11 |
| Universidad de La Salle (La Salle)location not on record | 11 |
| COLlocation not on record | 11 |
| Palmerston, AU | 11 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| UFSClocation not on record | 10 |
| Nishihara, JP | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Miami, US | 10 |
| Armidale, AU | 10 |
| Moscow State Universitylocation not on record | 10 |
| Loja, EC | 10 |
| Stockholm, SE | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| TAIElocation not on record | 9 |
| USP-IBlocation not on record | 9 |
| Tapachula, MX | 9 |
| Bogotá, D.C., CO | 9 |
| Chicago, US | 9 |
| Chongqing Museumlocation not on record | 8 |
| IPA/SPlocation not on record | 8 |
| UFPElocation not on record | 8 |
| EL PASO, US | 8 |
| Riverside, US | 7 |
| Tuxtla Gutiérrez, MX | 7 |
| Montréal, CA | 7 |
| Cambridge, US | 7 |
| QCNElocation not on record | 7 |
| Universidade Federal de Goiáslocation not on record | 7 |
| BMlocation not on record | 7 |
| Calabar, NG | 7 |
| HUAlocation not on record | 7 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 7 |
| ESALQlocation not on record | 6 |
| UFPRlocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Edinburgh, GB | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| UTPLlocation not on record | 6 |
| CHAPAlocation not on record | 6 |
| UFESlocation not on record | 6 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 5 |
| University of Papua New Guinealocation not on record | 5 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 5 |
| San Isidro, AR | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| MeiseBGlocation not on record | 5 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 5 |
| Tsukuba, JP | 5 |
| James Cook Townsvillelocation not on record | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 4 |
| NO DISPONIBLElocation not on record | 4 |
| BISHlocation not on record | 4 |
| Adelaide, AU | 4 |
| Davis, US | 4 |
| MAlocation not on record | 4 |
| UTFPR-SLlocation not on record | 4 |
| UNIVASFlocation not on record | 4 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| HACAMlocation not on record | 4 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| Beijing, CN | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Chaguaramas, TT | 4 |
| Burlington, US | 4 |
| UFOPlocation not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Fredericksburg, US | 3 |
| Universidad del Valle (UV)location not on record | 3 |
| Guatemala City, GT | 3 |
| INBIOlocation not on record | 3 |
| Chapingo, MX | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| South Kensington, GB | 3 |
| UNESClocation not on record | 3 |
| PUC-RSlocation not on record | 3 |
| Juriquilla, MX | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| SCZlocation not on record | 3 |
| UFABClocation not on record | 3 |
| URCAlocation not on record | 3 |
| Escuela Agrícola Panamericanalocation not on record | 3 |
| University of Zhejianglocation not on record | 3 |
| Universidad Nacional Agrarialocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Berea Collegelocation not on record | 2 |
| Universität Ulmlocation not on record | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Clemson, US | 2 |
| Riobamba, EC | 2 |
| FUVATESlocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Pondicherry, IN | 2 |
| UESBlocation not on record | 2 |
| Wlocation not on record | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| Herbario UTCEClocation not on record | 2 |
| Glocation not on record | 2 |
| OTSlocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Fort Worth, US | 2 |
| Hobart, AU | 2 |
| Fortaleza, BR | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| UNISANTAlocation not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Kagoshima, JP | 2 |
| CASlocation not on record | 2 |
| ASUlocation not on record | 2 |
| Fukushima Universitylocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Pittsburg, US | 1 |
| Elocation not on record | 1 |
| CUVClocation not on record | 1 |
| Ann Arbor, US | 1 |
| Jardín Botánico Nacional Dr. Rafael M. Moscosolocation not on record | 1 |
| Madison, US | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Ciudad de México, MX | 1 |
| McWane Science Centerlocation not on record | 1 |
| Göteborg, SE | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Sendai, JP | 1 |
| Ciudad de México, MX | 1 |
| FLASlocation not on record | 1 |
| Cibinong, ID | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Arequipa, PE | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| PHlocation not on record | 1 |
| US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Arusha, TZ | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Zürich, CH | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Phoenix, US | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Vancouver, CA | 1 |
| Lake Charles, US | 1 |
| Nagano City, JP | 1 |
| Provo, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Santa Teresa, BR | 1 |
| Tuscaloosa, US | 1 |
| Uppsala, SE | 1 |
| UTFPR-DVlocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Plocation not on record | 1 |
| Ilhéus, BR | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| Londrina, BR | 1 |
| UNIVILLElocation not on record | 1 |
| Brasília, BR | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| VALElocation not on record | 1 |
| IAPlocation not on record | 1 |
| UEGlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Chiba, JP | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
232 institutions · 3 274 of 3 998 vouchered records shown · 724 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.