Polygala nuttallii

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records349

Data sources8

Biological traits8

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Polygala nuttallii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility349 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF349 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Polygala nuttallii is a species of flowering plant in the milkwort family (Polygalaceae). It is endemic to the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala nuttallii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ888991.1 ↗798 bpUSA

ACGT

CCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA …

Polygala nuttallii voucher FLAS:Abbott 14373 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Polygala nuttallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · book-fedorov

CCDB · book-fedorov — Lewis W. H., Davis 1962

n 231×CCDB · Cave1962

CCDB · Cave1962 — Lewis & Davis 1962.

08Occurrence & distribution

Record type349 records

Museum / vouchered349

Range

Area of Occupancy AOO1 016 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 4≤1 km 58≤10 km 167>10 km 23

252 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence349

10Collections & institutions

Holding institutions25 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	136
Bronx, US	54
Chapel Hill, US	24
New Haven, US	17
Chongqing Museumlocation not on record	13
Burlington, US	10
College Park, US	10
Bangkok, TH	9
Williamsburg, US	6
University of Stellenboschlocation not on record	6
Bloomington, US	4
Dover, US	4
Tall Timbers Research Stationlocation not on record	4
Miami, US	3
Valdosta State Universitylocation not on record	3
Tuscaloosa, US	2
Durham, US	2
Millersville, US	2
Staten Island, US	2
BAYLUlocation not on record	2
EL PASO, US	2
ASUlocation not on record	2
Washington, US	1
New Brunswick, US	1
Knoxville, US	1
Allentown, US	1
Taipei, TW	1
AUAlocation not on record	1
Fairfax, US	1
Maryland Department of Natural Resourceslocation not on record	1
Columbia, US	1
Wuzhou, CN	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Madison, US	1
BClocation not on record	1

35 institutions · 330 of 349 vouchered records shown · 19 without an institution code

09Environmental DNA1 detections

Where the DNA of Polygala nuttallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)