Polygala lewtonii

Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records24

Data sources6

Biological traits8

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Polygala lewtonii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Polygala lewtonii is a rare species of flowering plant in the milkwort family known by the common name Lewton's polygala, or Lewton's milkwort. It is endemic to Florida in the United States, where it is limited to the central ridge of the peninsula. There are about 49 occurrences of the plant remaining.USFWS. Polygala lewtonii Five-year Review. August 2010. Most occurrences contain very few plants. The species is threatened by the loss and degradation of its habitat.Polygala lewtonii. The Nature Conservancy. This is a federally listed endangered species of the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala lewtonii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF155366.1 ↗677 bpUSA

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTACTCGAAAGAGCGATCGTTGGACCCGTGCATCTTTATGGGGGTGCGGCT …

Polygala lewtonii voucher FLAS:J.R.Abbott 22703 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type24 records

Museum / vouchered24

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤10 km 1>10 km 11

13 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence24

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	11
Saint Louis, US	7
University of Stellenboschlocation not on record	3
Bronx, US	1

4 institutions · 22 of 24 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Polygala lewtonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)