Polygala japonica
Houtt. · speciesAt a glance
Occurrence records4 861
Data sources10
Biological traits43
DNA specimens1
eDNA detections1
Sources10 archives
Databases and archives Polygala japonica's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 861 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Chemical compositionLOTUS · NPASS82 compounds
Occurrence & distributionGBIF4 861 records
Environmental DNA1 datasets · 1 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
01Narrative
Polygala japonica is a species of flowering plant in the milkwort family (Polygalaceae). It is native to Northeast, East and Southeastern Asia, as well as eastern Australia. It is a wiry and decumbent dwarf shrub with a height between 10 and 25 cm. Its stems have tiny curled hairs. Its leaves are 5 to long and 3 to wide. Its flowers are purple to mauve and 5 to long. It flowers between October and December.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsGIFTTRY
Size & morphology14
Fruit length6 mm
Fruit width8 mm
Leaf length20 mm
Leaf length max20 mm
Leaf length min5 mm
Leaf width8 mm
Leaf width max8 mm
Leaf width min3 mm
Plant height0.225 m
Plant height max0.3 m
Plant height min0.07 m
Seed length3 mm
Seed mass15 mg
Seed width2 mm
Life cycle & reproduction12
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
Flowering endDec
Flowering startMay
Flowering timennnnnnnnnyyy
Life formperennial or subshrub
Life spanperennial
Pollination syndromeinsect
Raunkiær life formcryptophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 100 m
Elevation mean1 450 m
Elevation min800 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: shrub
Habitat GIFTmeadows: dry, mountains
Leaf compoundnesssimple
Leaf shapeelliptical ovate
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition82 compounds
Compounds documented for Polygala japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids66
Cinnamic acids and derivatives2
Iridoids monoterpenoids2
Flavonols2
Neutral glycosphingolipids1
Documented compounds82 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,4aS,6aR,6aR,6bR,8aR,9R,10S,12aR,14bS)-2-[[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxymethyl]-10-hydroxy-6a,9-bis(hydroxymethyl)-2,6b,9,12a-tetramethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-5-[(2R,4S,5R)-4,5-dihydroxy-5-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxolan-2-yl]oxy-3,4-dihydroxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-5-[(2S,3R,4S)-3,4-dihydroxy-4-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxolan-2-yl]oxy-3,4-dihydroxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-5-[(2R,3R,4S,5R)-3,5-dihydroxy-4-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3-hydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyl-5-[(E)-3-(3,4,5-trimethoxyphenyl)prop-2-enoyl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]oxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5S)-5-[(2S,3R,4S)-3,4-dihydroxy-4-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxolan-2-yl]oxy-3,4-dihydroxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2R,4S,5R)-4,5-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4R)-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala japonica has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes3
GenBank sequences8
eDNA detections1
Countries2
The DNA barcodea real sequence read deposited for this species
CGCATCGTCGCCCTCCCCGCCTTCGCCTCATCTTTTGGGGCGAGGAGTTGGGGGGGACGGATGTTGGTCTCCGTGTGCCTCGGCATGCGG …
Polygala japonica isolate LS110 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL6★ITS2★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type4 861 records
Wild obs. + sensor1 966
Museum / vouchered2 840
Cultivated / captive3
Other52
Origin
Native67
Range
Area of Occupancy AOO11 028 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 937≤1 km 100≤10 km 58>10 km 86
1 181 georeferenced · 785 without coordinates
Open the mapobservation + sensor1 966
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 52≤1 km 99≤10 km 201>10 km 39
391 georeferenced · 2 449 without coordinates
Open the institutions mapphysical evidence2 840
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 3
3 georeferenced
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions73 of 138 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 216 |
| Nanjing, CN | 189 |
| Odawara, JP | 159 |
| Yangling, CN | 121 |
| Wuhan, CN | 99 |
| Guangzhou, CN | 90 |
| Nagano City, JP | 82 |
| Shinshu Universitylocation not on record | 81 |
| Kochi, JP | 68 |
| Kunming, CN | 63 |
| Guilin, CN | 61 |
| Chengdu, CN | 61 |
| Chiba, JP | 58 |
| Museo Entomologico de Leonlocation not on record | 56 |
| Mount Annan, AU | 56 |
| KR | 55 |
| Canberra, AU | 53 |
| Brisbane, AU | 51 |
| Sanda, JP | 49 |
| Shanghai, CN | 46 |
| Tomioka, JP | 45 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 44 |
| Taipei, TW | 39 |
| Nishihara, JP | 36 |
| Bando, JP | 36 |
| Nagatoro-machi, Chichibu-gun, JP | 34 |
| KURAlocation not on record | 33 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 33 |
| Sendai, JP | 32 |
| Tsukuba, JP | 32 |
| JP | 32 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 32 |
| Taipei, TW | 30 |
| Chengdu, CN | 29 |
| Toyama, JP | 27 |
| Central China Normal Universitylocation not on record | 24 |
| Anhui Normal Universitylocation not on record | 23 |
| Changsha, CN | 22 |
| Fukushima Universitylocation not on record | 22 |
| Wuhan, CN | 21 |
| KOMlocation not on record | 20 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 19 |
| Tokushima, JP | 19 |
| Seoul, KR | 18 |
| Armidale, AU | 17 |
| NSMKlocation not on record | 16 |
| Osaka, JP | 15 |
| Hangzhou, CN | 15 |
| Xiamen, CN | 14 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 14 |
| Guiyang, CN | 13 |
| Zhejiang Museum of Natural Historylocation not on record | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| Strecker Museum, Baylor Universitylocation not on record | 12 |
| TAIElocation not on record | 11 |
| Awka, NG | 11 |
| Kyoto Universitylocation not on record | 10 |
| Nishihara, JP | 9 |
| Moscow State Universitylocation not on record | 9 |
| Guiyang, CN | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 8 |
| FJIDClocation not on record | 8 |
| Xian, CN | 8 |
| EMTCMlocation not on record | 7 |
| Shanghai, CN | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Kagoshima, JP | 6 |
| Guangzhou, CN | 6 |
| Sagamihara, JP | 6 |
| Zhejiang Universitylocation not on record | 6 |
| Tianjin Natural History Museumlocation not on record | 5 |
| Fujian Institute of Subtropical Botanylocation not on record | 5 |
| Nagasaki University - Fisherieslocation not on record | 5 |
| Taipei, TW | 5 |
| Iwate Prefectural Museumlocation not on record | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Kushiro City Museumlocation not on record | 4 |
| Xining, CN | 4 |
| Port Elizabeth Museum (Bayworld)location not on record | 4 |
| Peking Universitylocation not on record | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Kew, GB | 3 |
| HUFDlocation not on record | 3 |
| Ischia Marine Centrelocation not on record | 3 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 3 |
| WNNUlocation not on record | 3 |
| Xinxiang, CN | 3 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Burlington, US | 2 |
| Lanzhou, CN | 2 |
| Minia, EG | 2 |
| Otaru, JP | 2 |
| Berlin, DE | 2 |
| Museo universitario di Chietilocation not on record | 2 |
| Beijing, CN | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Palmerston, AU | 2 |
| Bronx, US | 2 |
| South Kensington, GB | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Adelaide, AU | 2 |
| Chengdu, CN | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| FFPRIlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Wellington, NZ | 1 |
| KNAMlocation not on record | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
| SSNHlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Elocation not on record | 1 |
| GZUlocation not on record | 1 |
| LDlocation not on record | 1 |
| GNWPlocation not on record | 1 |
| SIHUlocation not on record | 1 |
| Wollongong, AU | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Smithfield, AU | 1 |
| Zhengzhou, CN | 1 |
| Xian, CN | 1 |
| KIWElocation not on record | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Fort Worth, US | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| ENTClocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Parkville, AU | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Nanchong, CN | 1 |
| Shenzhen, CN | 1 |
138 institutions · 2 821 of 2 840 vouchered records shown · 18 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA1 detections
Where the DNA of Polygala japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.9 °C 18.9–18.9
Seasonal swing summer↔winter9.90 °C
Max temp (day)22.0 °C
Min temp (night)14.7 °C
Precipitation328 mm/mo
Air humidity65.8 %
Moisture balance229 mm/mo
Vapour deficit751 Pa
Wind speed0.9 m/s
Cloud cover47.8 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.