Polygala hottentotta

C.Presl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records1 059

Data sources7

Biological traits15

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Polygala hottentotta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 059 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF1 059 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Polygala hottentotta is a species of flowering plant in the milkwort family (Polygalaceae). It is native to South Africa, Namibia, Lesotho, Mozambique, Eswatini, and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.45 m

Plant height max0.5 m

Plant height min0.15 m

Life cycle & reproduction2

Life formperennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 505 m

Elevation min5 m

Epiphyteterrestrial

Growth formherb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala hottentotta has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ888966.1 ↗764 bpSouth Africa

ACGT

GAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTACTCGAAAGAGCGACCGTTGGACAC …

Polygala hottentotta voucher FLAS:Abbott 24133 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 059 records

Wild obs. + sensor508

Museum / vouchered551

Range

Area of Occupancy AOO2 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 326≤1 km 74≤10 km 12>10 km 10

422 georeferenced · 86 without coordinates

Open the mapobservation + sensor508

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤1 km 5≤10 km 1

6 georeferenced · 545 without coordinates

Open the institutions mapphysical evidence551

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	427
Durban, ZA	85
Kew, GB	5
LNBG$location not on record	4
MeiseBGlocation not on record	3
Bronx, US	2
South African National Biodiversity Institute, Compton Herbariumlocation not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
University of Johannesburglocation not on record	1
Cape Town, ZA	1
Philadelphia, US	1
Saint Louis, US	1
WAGlocation not on record	1
South Kensington, GB	1

14 institutions · 536 of 551 vouchered records shown · 14 without an institution code

09Environmental DNA2 detections

Where the DNA of Polygala hottentotta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 19.3–23.8

Seasonal swing summer↔winter12.2 °C

Max temp (day)27.6 °C 26.8–28.4

Min temp (night)15.5 °C 12.5–18.6

Precipitation80.0 mm/mo 43.6–116

Air humidity54.1 % 49.4–58.7

Moisture balance-72.8 mm/mo -93.5–-52.2

Vapour deficit1,203 Pa 1,189–1,216

Wind speed2.90 m/s

Cloud cover30.3 % 19.1–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polygala hottentotta

At a glance

Sources7 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

At a glance

Record type1 059 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 059 records