Polygala glomerata
Lour. · speciesAt a glance
Occurrence records274
Data sources9
Biological traits32
DNA specimens0
eDNA detections3
Sources9 archives
Databases and archives Polygala glomerata's data was compiled from.
WikipediaWikimedia Foundation4 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility274 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources32 traits
Chemical compositionLOTUS · NPASS42 compounds
Occurrence & distributionGBIF274 records
Environmental DNA1 datasets · 2 countries3 detections
DNA & barcodingNCBIsequences
Genome at a glanceCCDB2n = 48
01Narrative
Polygala linariifolia is a species of flowering plant in the milkwort family (Polygalaceae). It is endemic to Australia, predominantly in New South Wales and Queensland.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesAusTraitsGIFTTRY
Size & morphology10
Fruit length3.5 mm
Leaf length25 mm
Leaf length max45 mm
Leaf length min5 mm
Leaf width5.5 mm
Leaf width max10 mm
Leaf width min1 mm
Plant height0.125 m
Plant height max0.75 m
Plant height min0.05 m
Life cycle & reproduction10
Dehiscencedehiscent
Dispersal typeanimal
Flowering endFeb
Flowering startSep
Flowering timeyynnnnnnyyyy
Life spanannual perennial
⚠ sources differ — AusTraits: annual perennial · GIFT: annual
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Leaf compoundnesssimple
Leaf shapenarrowly_elliptical narrowly_oblong obovate
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition42 compounds
Compounds documented for Polygala glomerata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids12
Cinnamic acids and derivatives6
Flavones6
Arylnaphthalene and aryltetralin lignans3
Unsaturated fatty acids3
Documented compounds42 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,3S,5R,6R,7S,10E,11E,15R,16R,17S,18R)-6,16,17,18-tetrahydroxy-10,11-bis[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]-3,5-bis(hydroxymethyl)-2,4,8,13,19-pentaoxatricyclo[13.3.1.03,7]nonadecane-9,12-dione | present | LOTUS | |
| (1R,3S,5R,6R,7S,10E,11E,15R,16S,17S,18R)-6,16,17,18-tetrahydroxy-10-[(4-hydroxy-2,3-dimethoxyphenyl)methylidene]-11-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]-3,5-bis(hydroxymethyl)-2,4,8,13,19-pentaoxatricyclo[13.3.1.03,7]nonadecane-9,12-dione | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-4-hydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-4-hydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4R,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]oxy-6-methyl-4-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4S,5R,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4S,5S,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4S,5S,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-[(Z)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS |
05DNA & barcoding4 sequences
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala glomerata has left across the world's sequence archives.
At a glance
Marker genes2
GenBank sequences4
eDNA detections3
Countries2
The DNA barcodea real sequence read deposited for this species
CGAAATGCGGAACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGC …
UNVERIFIED_ORG: Polygala glomerata isolate B5 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL1★ITS3
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Polygala glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 481×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Mitra, K. & Datta, N. 1967
n 241×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.
08Occurrence & distribution
Record type274 records
Museum / vouchered274
Origin
Native2
Range
Area of Occupancy AOO548 km²
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy
no georeferenced coordinates · 274 records without
Open the institutions mapphysical evidence274
10Collections & institutions
Holding institutions11 of 19 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Guilin, CN | 62 |
| Guangzhou, CN | 62 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 48 |
| Beijing, CN | 39 |
| Kunming, CN | 22 |
| Nanjing, CN | 8 |
| Guangzhou, CN | 6 |
| Xiamen, CN | 5 |
| Changsha, CN | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Yangling, CN | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| TAIElocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Wuhan, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Taipei, TW | 1 |
19 institutions · 269 of 274 vouchered records shown · 5 without an institution code
09Environmental DNA3 detections
Where the DNA of Polygala glomerata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map2 countries0
Shrubland at forest edgesSandy hillsides
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.8 °C 23.4–25.0
Seasonal swing summer↔winter11.8 °C
Max temp (day)26.1 °C 26.0–30.0
Min temp (night)19.5 °C 17.3–23.1
Precipitation327 mm/mo 66.5–439
Air humidity70.7 % 50.0–71.0
Moisture balance177 mm/mo -47.9–318
Vapour deficit941 Pa 850–1,490
Wind speed1.60 m/s 1.50–2.30
Cloud cover50.1 % 19.2–51.2
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.