Polygala fruticosa

P.J.Bergius · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records1 079

Data sources10

Biological traits15

DNA specimens5

eDNA detections4

Sources10 archives

Databases and archives Polygala fruticosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS84 compounds

Occurrence & distributionGBIF1 079 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Polygala fruticosa is a species of flowering plant in the milkwort family (Polygalaceae). It is native to Mozambique and South Africa. It was first described by Peter Jonas Bergius in 1767. According to the Red List of South African Plants, it is of least ecological concern.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max3.03 m

Plant height min0.5 m

Seed mass7.58 mg

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 010 m

Elevation min5 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition84 compounds

Compounds documented for Polygala fruticosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pregnane steroids51

Dicarboxylic acids3

Simple coumarins2

Disaccharides1

Cholane steroids $ Pregnane steroids1

Documented compounds84 total

Tissue Source Quantified only

Compound	Amount	Source
(1E,4S,5R,8S,13R,16R,19R,22R)-8-[(2R,3R,4R,5R,6R)-3-hydroxy-5-[(2S,4S,5S,6S)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-5,19-dimethyl-15,18,20-trioxapentacyclo[14.5.1.04,13.05,10.019,22]docosa-1,10-diene-14,21-dione	present	NPASS
(1S,2R,6R,7R,8aR)-7-hydroxy-6-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4S,5R,6S)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-8a-methyl-1-[3-(2-methylfuran-3-yl)-3-oxopropyl]-2,3,5,6,7,8-hexahydro-1H-naphthalene-2-carboxylic acid	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6,7-dihydroxy-2,4b-dimethyl-2-(2-methylfuran-3-yl)-4,4a,5,6,7,8,10,10a-octahydro-3H-phenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6,7-dihydroxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6-hydroxy-7-[(2R,4R,5S,6S)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6-hydroxy-7-[(2S,4R,5R,6R)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6-hydroxy-7-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4R,5S,6S)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6-hydroxy-7-[(2S,4S,5R,6R)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2S,4aS,4bR,6R,7R,10aR)-2,6-dihydroxy-7-[(2R,4R,5S,6S)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-4,4a,5,6,7,8,10,10a-octahydro-3H-phenanthren-1-one	present	NPASS
(2S,4aS,4bR,6R,7R,10aR)-2,6-dihydroxy-7-[(2S,4S,5R,6R)-5-[(2S,4S,5R,6S)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-4,4a,5,6,7,8,10,10a-octahydro-3H-phenanthren-1-one	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala fruticosa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ888955.1 ↗829 bpSouth Africa

ACGT

TGGGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTG …

Polygala fruticosa voucher K:Forest 254 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

07Deep time~4.17 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.17 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 079 records

Wild obs. + sensor731

Museum / vouchered348

Range

Area of Occupancy AOO1 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 522≤1 km 71≤10 km 17>10 km 11

621 georeferenced · 110 without coordinates

Open the mapobservation + sensor731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 3≤10 km 2

6 georeferenced · 342 without coordinates

Open the institutions mapphysical evidence348

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	235
Cape Town, ZA	56
Durban, ZA	33
Kew, GB	4
GJOlocation not on record	2
GHPG$location not on record	1
South African National Biodiversity Institutelocation not on record	1
University of Johannesburglocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Moscow State Universitylocation not on record	1
MSB-3054location not on record	1
Christchurch, NZ	1
Auckland, NZ	1

13 institutions · 338 of 348 vouchered records shown · 9 without an institution code

09Environmental DNA4 detections

Where the DNA of Polygala fruticosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 17.2–19.7

Seasonal swing summer↔winter14.8 °C

Max temp (day)26.6 °C 24.3–26.7

Min temp (night)11.7 °C 10.8–12.6

Precipitation34.5 mm/mo 19.3–44.0

Air humidity49.2 % 48.5–54.2

Moisture balance-99.7 mm/mo -109–-98.8

Vapour deficit1,186 Pa 918–1,246

Wind speed2.90 m/s 2.90–4.20

Cloud cover14.4 % 11.4–15.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polygala fruticosa

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment8

Other traits1

Compound class profile5 classes

Documented compounds84 total

At a glance

At a glance

When this lineage existed

Record type1 079 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 079 records