Polygala brevifolia

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Polygala

At a glance

Occurrence records212

Data sources6

Biological traits8

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Polygala brevifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF212 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

مغزرة قصيرة الأوراق هي نوع من النباتات تتبع جنس المغزرة من الفصيلة المغزرية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygala brevifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ888935.1 ↗809 bpUSA

ACGT

TGGGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTG …

Polygala brevifolia voucher FLAS:Abbott 13675 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type212 records

Museum / vouchered212

Range

Area of Occupancy AOO548 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 8≤1 km 45≤10 km 69>10 km 36

158 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence212

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	98
Bronx, US	16
Bangkok, TH	14
Chongqing Museumlocation not on record	12
Chapel Hill, US	8
Miami, US	8
US	6
Tuscaloosa, US	5
Saint Louis, US	4
Tall Timbers Research Stationlocation not on record	4
AUAlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Bloomington, US	3
Staten Island, US	3
Durham, US	2
Jena Microbial Resource Collectionlocation not on record	2
Millersville, US	2
Mississippi State, US	2
ASUlocation not on record	2
University of Stellenboschlocation not on record	1
Fort Worth, US	1
Valdosta State Universitylocation not on record	1
Chicago, US	1
Burlington, US	1
BClocation not on record	1

25 institutions · 204 of 212 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Polygala brevifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)