Polyalthia longifolia

(Sonn.) Thwaites · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Polyalthia

At a glance

Occurrence records246

Data sources13

Biological traits21

DNA specimens0

eDNA detections27

Sources13 archives

Databases and archives Polyalthia longifolia's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources21 traits

Chemical compositionLOTUS · NPASS105 compounds

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 4 countries27 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.1 Gbp

01Narrative

Seeds and fruit of M. longifolium Monoon longifolium, the false ashoka, also commonly known by its synonym Polyalthia longifolia, is an Asian small tree species in the family Annonaceae. It is native to southern India and Sri Lanka, but has been widely introduced elsewhere in tropical Asia.Plants of the World Online (POWO): Monoon longifolium (Sonn.) B.Xue & R.M.K.Saunders (retrieved 30 August 2020) This evergreen tree is known to grow over 20 m. in height and is commonly planted due to its effectiveness in alleviating noise pollution. It exhibits symmetrical pyramidal growth with willowy weeping pendulous branches and long narrow lanceolate leaves with undulate margins. Monoon longifolium is sometimes incorrectly identified as the ashoka tree (Saraca indica) because of the close resemblance of both trees. It can appear to have no branches, but in fact a M. longifolium allowed to grow naturally (without trimming the branches out for decorative reasons) grows into a normal large tree giving plenty of shade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology5

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 16 m

Seed length20 mm

Seed mass1 674 mg

Seed mass max1 681 mg

Seed mass min1 667 mg

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio22.85 g/g

Leaf c481 mg/g

Leaf n21.2 mg/g

Leaf p1.95 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)15.77 mm²/mg

Wood density564 mg/cm³

03Chemical composition105 compounds

Compounds documented for Polyalthia longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Colensane and Clerodane diterpenoids33

Aporphine alkaloids $ Isoquinoline alkaloids10

Cinnamic acid amides9

Isoquinoline alkaloids $ Protoberberine alkaloids9

Isoquinoline alkaloids9

Documented compounds105 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Stepholidine	present	LOTUS
(12S,13S)-11-methyl-11-oxido-3,5-dioxa-11-azoniapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-13-ol	present	LOTUS
(13aS)-10-hydroxy-2,3,9-trimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-11-hydroxy-2,3,9,10-tetramethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-11-hydroxy-2,3,9-trimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-2,10-dihydroxy-3,9,11-trimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-2,11-dihydroxy-3,10-dimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-2,9,11-trihydroxy-3,10-dimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-3,10-dihydroxy-9,11-dimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS
(13aS)-9,10-dihydroxy-2,3-dimethoxy-5,6,13,13a-tetrahydroisoquinolino[2,1-b]isoquinolin-8-one	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polyalthia longifolia has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections27

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMW355069.1 ↗255 bp

ACGT

ACCGGGTGTCGTGGGATTGGGTGTGAGCCTTAGCCCTACGATGCTTGTCGGCATGCGTGCAAGGTGCTTATCTCTAGGCATCGTGGACGT …

Monoon longifolium isolate PL1 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Polyalthia longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 075 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Polyalthia longifolia1.08 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol1 · CCDB · eflora +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-indian_vol1 — Asana, J.J. & Adatia, R.D. 1945

CCDB · eflora

CCDB · book-atlas-flowering-plants — Asana & A. 1945

CCDB · kew — Ohri D, Kumar A. 1986. Nuclear DNA amounts in some tropical hardwoods. Caryologia 39: 303-307.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~5.84 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.84 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type246 records

Wild obs. + sensor150

Museum / vouchered49

Cultivated / captive2

Other45

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 8≤1 km 63≤10 km 4>10 km 11

86 georeferenced · 64 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤10 km 4

6 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence49

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	6
Baroda, IN	6
Pondicherry, IN	6
Saint Louis, US	4
Leiden University Medical Centerlocation not on record	3
EL PASO, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Berlin, DE	2
St. Augustine, TT	2
Antiguo Cuscatlán, SV	2
UEPAlocation not on record	1
Nnamdi Azikiwe University Herbarium (NAUH)location not on record	1
Mexico City, MX	1
Riverside, US	1
Moscow State Universitylocation not on record	1
Zürich, CH	1
UFABClocation not on record	1
Londrina, BR	1
HNBlocation not on record	1
San José, CR	1
León, NI	1
Fort Worth, US	1

22 institutions · 47 of 49 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Polyalthia longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map4 countries0

Garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 18.2–26.7

Seasonal swing summer↔winter14.6 °C

Max temp (day)29.7 °C 25.6–30.5

Min temp (night)19.3 °C 12.2–23.5

Precipitation109 mm/mo 9.00–252

Air humidity52.0 % 51.6–67.5

Moisture balance-47.1 mm/mo -82.6–120

Vapour deficit1,194 Pa 1,007–1,616

Wind speed2.00 m/s 1.60–5.60

Cloud cover26.4 % 21.7–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)