Polyachyrus poeppigii

Kunze ex Less. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Polyachyrus

At a glance

Occurrence records160

Data sources5

Biological traits12

DNA specimens0

eDNA detections3

Sources5 archives

Databases and archives Polyachyrus poeppigii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Polyachyrus poeppigii is a species in the daisy family that has segmented leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass1.74 mg

Seed mass max1.74 mg

Seed mass min1.74 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polyachyrus poeppigii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEF530234.1 ↗737 bp

ACGT

TATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAGGCAGAACGACC …

Polyachyrus poeppigii subsp. poeppigii voucher Bonifacino 1356 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type160 records

Wild obs. + sensor132

Museum / vouchered26

Cultivated / captive2

Origin

Native4

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 69≤1 km 25≤10 km 16>10 km 3

113 georeferenced · 19 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	5
Edinburgh, GB	4
Viña del Mar, CL	4
Valparaíso, CL	3
Valparaiso, CL	2
EL PASO, US	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1
ASUlocation not on record	1
UNESP-FCAlocation not on record	1
MeiseBGlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Saint Louis, US	1

13 institutions · 26 of 26 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Polyachyrus poeppigii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)