Pollichia campestris

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Pollichia

At a glance

Occurrence records992

Data sources9

Biological traits19

DNA specimens22

eDNA detections7

Sources9 archives

Databases and archives Pollichia campestris's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility992 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF992 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Pollichia campestris, commonly known as waxberry or barley sugar bush, is a herbaceous plant in the family Caryophyllaceae and the only species in the monotypic genus Pollichia. It is found in southern and eastern Africa and in the Arabian peninsula.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.6 m

Plant height max1.5 m

Plant height min0.8 m

Seed mass0.598 mg

⚠ sources differ — TRY: 0.598 mg · GIFT: 1.09 mg

Seed mass max3.66 mg

Seed mass min0.37 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Shrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition0 compounds

No individual compounds documented yet for Pollichia campestris — the badge(s) below come from traditional/economic-use records, not from a chemical analysis.

🍽 Used in cooking🌿 Fruit

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pollichia campestris has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes6

GenBank sequences10

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKR733964.1 ↗337 bpKenya · 2014

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCACAGCAGAACGACCCGTGAACATGTTATTCTTGCATGGGGGCGGG …

Pollichia campestris 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★trnL-F★ITS6trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pollichia campestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · book-fedorov

CCDB · book-fedorov — Riley H. P., Hoff 1961 .

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type992 records

Wild obs. + sensor382

Museum / vouchered608

Other2

Range

Area of Occupancy AOO2 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 227≤1 km 42≤10 km 9>10 km 7

285 georeferenced · 97 without coordinates

Open the mapobservation + sensor382

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 1≤1 km 12>10 km 1

14 georeferenced · 594 without coordinates

Open the institutions mapphysical evidence608

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	405
Durban, ZA	42
Cape Town, ZA	31
Kew, GB	25
Saint Louis, US	9
MeiseBGlocation not on record	8
Uppsala, SE	7
Instituto de Investigação Científica Tropicallocation not on record	6
MSB-3054location not on record	5
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	4
Berlin, DE	3
Adam Mickiewicz University in Poznańlocation not on record	3
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
North-West University, A.P. Goossens Herbariumlocation not on record	1
Philadelphia, US	1
CJBGlocation not on record	1
MSB-3159location not on record	1
Bronx, US	1
Boise, US	1
National Museums of Kenyalocation not on record	1
Moscow State Universitylocation not on record	1
University of Stellenboschlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Chongqing Museumlocation not on record	1
LDlocation not on record	1
Universität Göttingenlocation not on record	1
LNBG$location not on record	1
Edinburgh, GB	1

28 institutions · 564 of 608 vouchered records shown · 44 without an institution code

09Environmental DNA7 detections

Where the DNA of Pollichia campestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

red soil,acacia bushland,growing near acacia…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–22.4

Seasonal swing summer↔winter2.60 °C

Max temp (day)24.9 °C 24.9–27.7

Min temp (night)13.0 °C 13.0–16.6

Precipitation31.8 mm/mo 31.8–49.1

Air humidity53.8 % 53.1–53.8

Moisture balance-111 mm/mo -111–-95.7

Vapour deficit1,032 Pa 1,032–1,292

Wind speed2.70 m/s 2.40–2.70

Cloud cover33.9 % 30.5–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)