Pollia crispata

(R.Br.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Pollia

At a glance

Occurrence records1 203

Data sources9

Biological traits25

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Pollia crispata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF1 203 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Pollia crispata is a perennial herb found in rainforest or rainforest margins in eastern Australia. The specific epithet crispata is derived from Latin, meaning "wavy".Les Robinson - Field Guide to the Native Plants of Sydney, page 385 Found from near Nowra in New South Wales to tropical Queensland. It is one of the many plants first described by Robert Brown with the type known as "(J.) v.v." Published in his Prodromus Florae Novae Hollandiae et Insulae Van Diemen in 1810, the plant was later moved by the systematic botanist George Bentham into the genus Pollia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length5.5 mm

Leaf length145 mm

Leaf length max190 mm

Leaf length min100 mm

Leaf width27.5 mm

Leaf width max35 mm

Leaf width min20 mm

Plant height1 m

Plant height max1 m

Seed mass0.794 mg

Life cycle & reproduction3

Flowering timennnnnnnnnnyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_ovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pollia crispata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895594.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATAACCAAGGATACTGATATATTGGCAGC …

Pollia crispata voucher 1076420446 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pollia crispata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Briggs 1966

CCDB · book-fedorov — Briggs 1966

n 161×CCDB · book-ipcn66

CCDB · book-ipcn66 — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 203 records

Wild obs. + sensor941

Museum / vouchered213

Cultivated / captive3

Fossil1

Other45

Origin

Native60

Introduced1

Range

Area of Occupancy AOO3 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 712≤1 km 70≤10 km 38>10 km 15

835 georeferenced · 106 without coordinates

Open the mapobservation + sensor941

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 28≤1 km 20≤10 km 98>10 km 34

180 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	60
Brisbane, AU	58
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	20
Armidale, AU	13
Smithfield, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Wollongong, AU	4
John T. Waterhouse Herbariumlocation not on record	4
Kew, GB	2
Adelaide, AU	2
Saint Louis, US	2
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
US	1
IPA/SPlocation not on record	1
Honolulu, US	1
Cambridge University Herbariumlocation not on record	1

18 institutions · 205 of 213 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pollia crispata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pollia crispata

At a glance

Sources9 archives

Size & morphology10

Life cycle & reproduction3

Diet & foraging1

Habitat & environment10

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 203 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 203 records