Polistes carnifex

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eumenidae/Polistes

At a glance

Occurrence records1 060

Data sources7

Biological traits0

DNA specimens14

eDNA detections11

Sources7 archives

Databases and archives Polistes carnifex's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 060 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 060 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD14 specimens

01Narrative

Polistes carnifex, commonly known as the executioner wasp, is a neotropical vespid wasp in the cosmopolitan genus Polistes, known for its extremely painful and potent sting. It is a very large yellow and brown paper wasp with a mandible that contains teeth. It establishes small colonies, founded by solitary queens, which build nests under the eaves of buildings or suspended from branches. Foraging adults bring nectar and macerated prey back to the nest to feed to the developing larvae which are individually housed in separate cells in the nest.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polistes carnifex has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)5.9%

Haplotypes1

BINs2

Where individuals differ — all 86 variable positions, in barcode order

30Avariable

39Amostly conserved

57Tmostly conserved

81Amostly conserved

82Amostly conserved

99Cmostly conserved

108Amostly conserved

126Amostly conserved

129Avariable

135Amostly conserved

136Cvariable

150Tmostly conserved

159Gvariable

165Tmostly conserved

186Tvariable

208Amostly conserved

216Tmostly conserved

219Tmostly conserved

225Amostly conserved

231Tvariable

237Amostly conserved

267Cmostly conserved

277Tmostly conserved

279Amostly conserved

288Tmostly conserved

298Tmostly conserved

300Amostly conserved

304Amostly conserved

306Tvariable

315Amostly conserved

336Tvariable

339Amostly conserved

343Tmostly conserved

345Amostly conserved

353Amostly conserved

355Tmostly conserved

360Tmostly conserved

363Cmostly conserved

369Amostly conserved

375Amostly conserved

376Amostly conserved

378Tmostly conserved

384Tmostly conserved

385Tmostly conserved

387Amostly conserved

408Amostly conserved

411Tvariable

414Tmostly conserved

417Tmostly conserved

429Tmostly conserved

435Tmostly conserved

441Tmostly conserved

454Amostly conserved

456Tmostly conserved

465Tmostly conserved

468Amostly conserved

474Amostly conserved

481Amostly conserved

483Tmostly conserved

495Tvariable

501Tmostly conserved

502Tmostly conserved

504Amostly conserved

522Tmostly conserved

529Tmostly conserved

531Amostly conserved

538Cvariable

543Tmostly conserved

549Tmostly conserved

552Tmostly conserved

558Amostly conserved

567Tmostly conserved

574Cmostly conserved

582Amostly conserved

585Cmostly conserved

591Cmostly conserved

592Tvariable

594Amostly conserved

600Amostly conserved

615Tmostly conserved

616Tmostly conserved

627Tmostly conserved

630Cvariable

633Tmostly conserved

637Cmostly conserved

642Tmostly conserved

TTATATTTTATATTTGGATTATGATCAGGAATAATTGGAACATCATTAAGATTAATTATTCGATTAGAATTAGGAACACCAATATCAATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polistes dorsalissame genus10.7%Polistes buyssonisame genus10.9%Polistes japonicussame genus11.2%Polistes metricussame genus11.5%Polistes flavussame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 060 records

Wild obs. + sensor990

Museum / vouchered70

Range

Area of Occupancy AOO2 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 420≤1 km 204≤10 km 90>10 km 31

745 georeferenced · 245 without coordinates

Open the mapobservation + sensor990

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 2≤1 km 13≤10 km 25>10 km 1

41 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	25
Universidad del Quindío (UniQuindío)location not on record	10
Ciudad de México, MX	8
Natural History Museum Rotterdamlocation not on record	8
Provincia di Livornolocation not on record	5
OSUClocation not on record	4
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	4
	3
ASUlocation not on record	2
Tapachula, MX	1

10 institutions · 70 of 70 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Polistes carnifex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 22.0–27.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)26.6 °C 25.5–30.3

Min temp (night)23.2 °C 19.1–25.0

Precipitation253 mm/mo 87.7–361

Air humidity67.4 % 64.0–73.9

Moisture balance110 mm/mo

Vapour deficit943 Pa 691–1,262

Wind speed2.60 m/s

Cloud cover31.5 % 17.0–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polistes carnifex

At a glance

Sources7 archives

At a glance

Record type1 060 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 060 records