Polemonium acutiflorum
Willd. ex Roemer & J.A.Schultes · speciesAt a glance
Occurrence records2 664
Data sources10
Biological traits92
DNA specimens21
eDNA detections10
Sources10 archives
Databases and archives Polemonium acutiflorum's data was compiled from.
GBIFGlobal Biodiversity Information Facility2 664 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements3 literature sources92 traits
Occurrence & distributionGBIF2 664 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB2n = 18
02Traits & measurements
SourcesGIFTUSDATRY
Size & morphology5
Leaf size1 556 mm²
Plant height0.91 m
⚠ sources differ — GIFT: 0.91 m · USDA: 0.914 m · TRY: 0.442 m
Plant height max0.9 m
Plant height min0.3 m
Seed mass0.974 mg
Life cycle & reproduction25
After harvest regrowth rateModerate
Bloom periodSummer
Coppice potentialNo
Flower colourblue
Flower conspicuousYes
Flowering endJul
Flowering startJul
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDARapid
Life spanperennial
Lifespan categoryShort
Lifespan years3 years
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment24
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureMedium
Growth formherb
Growth form USDARhizomatous
Habitat GIFTlakes, mountains, rivers, swamps, tundra
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceLow
C:N ratioMedium
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantNo
Frost free days min47 days
Leaf c434 mg/g
Leaf n24.7 mg/g
Leaf p3.99 mg/g
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max276 in
Precipitation min9 in
Salinity toleranceNone
Shade toleranceLow
Soil pH max7.8 pH
Soil pH min5 pH
Specific leaf area (SLA)27.86 mm²/mg
Temperature min-62 °F
Uses & economy12
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound464 940 per lb
Veneer productNo
Other traits5
Fall conspicuousNo
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max20 000 per acre
Planting density min5 120 per acre
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polemonium acutiflorum has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes6
GenBank sequences6
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCACATC …
Polemonium acutiflorum voucher CCDB-18333-G1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Polemonium acutiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records14–182n range18median18mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1819×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +4
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1989. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 74: 1059–1061.
CCDB · ipcn-api-dl — Murray, D. F. & S. Kelso. 1997. Chromosome numbers and notes on the taxonomy of selected Alaskan vascular plants. Rhodora 99: 33–55.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1981a. In Chromosome number reports LXX. Taxon 30: 70–72.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Volkova, S. A. & D. D. Basargin. 2002. Chromosome numbers of species of Chabarovsk territory flora. Bot. Žhurn. (Moscow & Leningrad) 87(4): 165–167.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn75-78 — Krogulevi~h 1976
CCDB · book-fedorov — CoKoJioBcKaJI 1963
CCDB · book-atlas-flowering-plants — Nygren, L. & L. '48
CCDB · Cave1963 — Sokolovskaya 1963
2n 141×CCDB · eflora
CCDB · eflora
n 92×CCDB · book-ipcn73-74 · CCDB · Cave1963
CCDB · book-ipcn73-74 — MULLIGAN, G.A., & W.J. CODY. 197 3. In IOPB chromosome number reports! XL. Taxon 22: 258-291.
CCDB · Cave1963 — Sorsa 1963c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 664 records
Wild obs. + sensor2 037
Museum / vouchered585
Other42
Range
Area of Occupancy AOO8 304 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 748≤1 km 209≤10 km 347>10 km 385
1 689 georeferenced · 348 without coordinates
Open the mapobservation + sensor2 037
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy23% within 1 km
≤100 m 15≤1 km 18≤10 km 38>10 km 75
146 georeferenced · 439 without coordinates
Open the institutions mapphysical evidence585
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions29 of 49 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Victoria, CA | 111 |
| LDlocation not on record | 75 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 60 |
| Vancouver, CA | 29 |
| Yukon Universitylocation not on record | 29 |
| University of Stellenboschlocation not on record | 28 |
| Oskarshamn, SE | 21 |
| University of Alberta Museumslocation not on record | 19 |
| WTUlocation not on record | 19 |
| Chongqing Museumlocation not on record | 17 |
| Pullman, US | 16 |
| Whitehorse, CA | 10 |
| Stockholm, SE | 9 |
| Wuzhou, CN | 7 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 7 |
| Uppsala, SE | 6 |
| Jyväskylä, FI | 5 |
| Claremont, US | 4 |
| Tempe, US | 4 |
| Flagstaff, US | 4 |
| Logan, US | 3 |
| ASUlocation not on record | 3 |
| Philadelphia, US | 3 |
| Moscow, US | 3 |
| Bronx, US | 3 |
| Osaka, JP | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| BRNUlocation not on record | 2 |
| Wlocation not on record | 2 |
| Albuquerque, US | 2 |
| Frankfurt am Main | 2 |
| Tromso University Museumlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| University of Lethbridgelocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Boise, US | 1 |
| Cambridge, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| San Francisco, US | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Williamsburg, US | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Tampa, US | 1 |
| Saint Louis, US | 1 |
| US | 1 |
| Provo, US | 1 |
| Riverside, US | 1 |
| Madison, US | 1 |
49 institutions · 532 of 585 vouchered records shown · 53 without an institution code
09Environmental DNA10 detections
Where the DNA of Polemonium acutiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
Silty, sandy soil in Salix exigua thicket, r…Hygric-mesic subalpine mossy (Sphagnum) rivu…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 6.00–15.7
Seasonal swing summer↔winter29.7 °C
Max temp (day)17.3 °C 9.40–19.5
Min temp (night)9.10 °C 2.90–11.6
Precipitation94.0 mm/mo 60.4–111
Air humidity59.3 % 55.2–64.9
Moisture balance5.80 mm/mo -46.1–22.0
Vapour deficit679 Pa 325–744
Wind speed2.60 m/s 2.00–4.40
Cloud cover57.4 % 42.1–66.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.