Polanisia tenuifolia

Leconte ex Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Cleomaceae/Polanisia

At a glance

Occurrence records151

Data sources8

Biological traits8

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Polanisia tenuifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF151 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Polansia tenuifolia is a species of flowering plant in the family Cleomaceae. It grows in Florida. It is known by the common names pineland catchfly and slender-leaf clammyweed (or slenderleaf clammyweed). It is synonymous with Aldenella tenuifolia, Cleome aldanella, Cleome tenuifolia, and Jacksonia tenuifolia. It is an annual.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polanisia tenuifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627372.1 ↗560 bp

ACGT

CAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTG …

Polanisia tenuifolia voucher FLAS:Whitten 3921 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Polanisia tenuifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type151 records

Museum / vouchered151

Range

Area of Occupancy AOO384 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 5≤10 km 14>10 km 35

56 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence151

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	46
Miami, US	37
Bronx, US	11
Bangkok, TH	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Valdosta State Universitylocation not on record	6
US	3
Chapel Hill, US	3
Tall Timbers Research Stationlocation not on record	3
Saint Louis, US	3
Canadian Department of Agriculturelocation not on record	2
University of Stellenboschlocation not on record	2
Knoxville, US	2
Bloomington, US	2
Durango, MX	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Columbia, US	1
Philadelphia, US	1
Phoenix, US	1
Tempe, US	1
Clemson, US	1
McWane Science Centerlocation not on record	1
University of Southern Mississippilocation not on record	1
Brookings, US	1

24 institutions · 145 of 151 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)