Podothecus sturioides

(Guichenot, 1869) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Agonidae/Podothecus

At a glance

Occurrence records54

Data sources8

Biological traits8

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Podothecus sturioides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

OBISOcean Biodiversity Information System33 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS54 records

DNA & barcodingBOLD4 specimens

01Narrative

Podothecus sturioides is a fish in the family Agonidae (poachers).Podothecus sturioides at www.fishbase.org. It was described by Alphone Guichenot in 1869.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length29 cm

Body mass192 g

Life cycle & reproduction1

Max. longevity72 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max432 m

Depth min8 m

Vulnerability19

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podothecus sturioides has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P598 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

107Cmostly conserved

317Avariable

344Amostly conserved

575Tmostly conserved

AGCTGAGCCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTACAATGTAATTGTTACGGCCCATGCTTTCGTAATAATCTTCTTTATAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes3

BIN1

Most divergent pair0.50%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Podothecus veternussame genus2.6%Podothecus accipenserinussame genus3.3%Sarritor leptorhynchussame family5.1%Leptagonus decagonussame family6.0%Sarritor frenatussame family6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor1

Museum / vouchered53

Range

Area of Occupancy AOO132 km²

Depth

0–200 m sunlit19

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 77 m · max 170.1 m · 19 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1>10 km 2

3 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	9
Vancouver, CA	5
University of Mazandaranlocation not on record	1
Paris, FR	1

4 institutions · 16 of 53 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)