Podosphaera macularis

(Wallr.) U.Braun & S.Takam. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Podosphaera

At a glance

Occurrence records1 075

Data sources8

Biological traits0

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Podosphaera macularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 075 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 075 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Podosphaera macularis (formerly Sphaerotheca macularis) is a plant pathogen infecting several hosts including chamomile, caneberrie, strawberries, hop, hemp and Cineraria. It causes powdery mildew of hops.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podosphaera macularis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV665461.1 ↗379 bpUSA · 2024

ACGT

CTGATTATGTTGCTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCACTCATGTAGTTAGTGC …

Podosphaera macularis isolate H2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 075 records

Wild obs. + sensor495

Museum / vouchered564

Other16

Range

Area of Occupancy AOO3 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 267≤1 km 55≤10 km 101>10 km 9

432 georeferenced · 63 without coordinates

Open the mapobservation + sensor495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 10≤1 km 388≤10 km 89>10 km 20

507 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence564

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	438
Tartu, EE	28
Karlsruhe, DE	25
Helsinki, FI	14
Trondheim, NO	11
Museo Entomologico de Leonlocation not on record	8
Görlitz, DE	7
TROMlocation not on record	6
WU-MYClocation not on record	6
Catholic University of Pekinglocation not on record	4
DPIlocation not on record	3
Logan, US	2
Tilburg, NL	2
Champaign, US	2
Cincinnati, US	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
University of Tennessee at Chattanoogalocation not on record	1
Kuopio, FI	1
Kew, GB	1
LDlocation not on record	1
Canberra, AU	1

21 institutions · 563 of 564 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Podosphaera macularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Podosphaera macularis

At a glance

Sources8 archives

At a glance

Record type1 075 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 075 records