Podolepis robusta

(Maiden & Betche) J.H.Willis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Podolepis

At a glance

Occurrence records968

Data sources9

Biological traits37

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Podolepis robusta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility968 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF968 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Podolepis robusta, commonly known as alpine podolepis, mountain lettuce or cattleman's lettuce, is a perennial herb from the Australian Alps in the family Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology14

Fruit length2.75 mm

Leaf length100 mm

Leaf length max200 mm

Leaf mass per area89.83 g/m2

Leaf size2 751 mm²

⚠ sources differ — TRY: 2 751 mm² · AusTraits: 3 074 mm²

Leaf width20 mm

Plant height0.6 m

⚠ sources differ — AusTraits: 0.6 m · TRY: 0.137 m

Plant height max0.6 m

Plant height min0.2 m

Seed length3.01 mm

Seed mass0.621 mg

⚠ sources differ — TRY: 0.621 mg · AusTraits: 0.97 mg · GIFT: 0.62 mg

Seed mass max0.62 mg

Seed mass min0.62 mg

Seed width1.11 mm

Life cycle & reproduction8

Dispersal typewind

Flowering timeyynnnnnnnnny

Life span>15

⚠ sources differ — TRY: >15 · AusTraits: perennial · GIFT: perennial

Lifespan years15 years

Pollination syndromeinsect

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeoblanceolate

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)176 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.66 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podolepis robusta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAB033309.1 ↗641 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACNCGCGAACACGTAACTACTAGCGGGAAACAAAGGGATTGAGCTAGCGCTTGGTCTCCTGTTTCCCT …

Podolepis robusta gene for ITS1, 5.8S ribosomal RNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Podolepis robusta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, N. Konishi, M. Ito & K. Kosuge. 1999. Asteraceae: chromosome numbers and karyotypes in the Australian Gnaphalieae and Plucheeae. Austral. Syst. Bot. 12: 781–802.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.955 ↗

08Occurrence & distribution

Record type968 records

Wild obs. + sensor673

Museum / vouchered280

Cultivated / captive15

Origin

Native57

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 347≤1 km 148≤10 km 67>10 km 3

565 georeferenced · 108 without coordinates

Open the mapobservation + sensor673

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 31≤1 km 53≤10 km 138>10 km 21

243 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence280

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 8

15 georeferenced

Open the mapnot free-living15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	90
Canberra, AU	69
Mount Annan, AU	55
Adelaide, AU	21
Brisbane, AU	9
La Trobe Universitylocation not on record	9
Parkville, AU	7
Hobart, AU	4
Armidale, AU	4
Kew, GB	3
Stockholm, SE	2
John T. Waterhouse Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Wuzhou, CN	1
Palmerston, AU	1

15 institutions · 279 of 280 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Podolepis robusta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)