Podolepis gracilis

Graham · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Podolepis

At a glance

Occurrence records687

Data sources9

Biological traits28

DNA specimens2

eDNA detections14

Sources9 archives

Databases and archives Podolepis gracilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility687 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF687 records

Environmental DNA2 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Podolepis gracilis (common name slender podolepis) is a slender, perennial herb native to Western Australia, belonging to the Asteraceae family.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length100 mm

Leaf width20 mm

Plant height0.5 m

Plant height max0.5 m

Plant height min0.1 m

Seed length1.07 mm

Seed mass0.326 mg

⚠ sources differ — TRY: 0.326 mg · AusTraits: 0.223 mg

Seed width0.33 mm

Life cycle & reproduction7

Flowering timeynnnyyyyyyyy

Life formannual

Life spanannual

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeoblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podolepis gracilis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB033299.1 ↗640 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACATGTAACTACTAGCGGGCAACATAGGGATTGAGCTACCGCTTGATCCCCATTTGCCCT …

Podolepis gracilis gene for ITS1, 5.8S ribosomal RNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Podolepis gracilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 121×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — TURNER, B. L. 1967. Chromosome survey of Podolepis (Compositae-Inuleae). Austral. Jour. Bot. 15: 445-449.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.954 ↗

08Occurrence & distribution

Record type687 records

Wild obs. + sensor343

Museum / vouchered343

Cultivated / captive1

Origin

Native17

Introduced1

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 197≤1 km 96≤10 km 5>10 km 15

313 georeferenced · 30 without coordinates

Open the mapobservation + sensor343

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 68≤1 km 33≤10 km 134>10 km 36

271 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence343

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	173
Museo Entomologico de Leonlocation not on record	78
Canberra, AU	38
Adelaide, AU	14
Brisbane, AU	7
CJBGlocation not on record	6
LDlocation not on record	6
Stockholm, SE	5
Mount Annan, AU	4
Kew, GB	4
BGPAlocation not on record	4
Claremont, US	1
Hobart, AU	1
Armidale, AU	1
Wlocation not on record	1

15 institutions · 343 of 343 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Podolepis gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–17.6

Seasonal swing summer↔winter12.2 °C

Max temp (day)24.1 °C

Min temp (night)11.2 °C

Precipitation25.3 mm/mo

Air humidity53.3 %

Moisture balance-136 mm/mo

Vapour deficit938 Pa

Wind speed4.40 m/s

Cloud cover12.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)