Podolepis canescens

A.Cunn. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Podolepis

At a glance

Occurrence records762

Data sources10

Biological traits35

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Podolepis canescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF762 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Podolepis canescens (common names - grey podolepis, large copper wire daisy) is a herb in the Asteraceae family, which is found in South Australia, the Northern Territory, New South Wales and Victoria. PlantNet also states that it is found in Western Australia, but FloraBase states that the name is misapplied in Western Australia, based on Jeanes (2015). It was first described in 1838 by Allan Cunningham and published in Augustin Pyramus de Candolle's Prodromus Systematis Naturalis Regni Vegetabilis. Jeffrey Jeanes (2015) recognises only specimens from New South Wales as belonging to the species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology12

Fruit length1.75 mm

Leaf length45 mm

Leaf length max70 mm

Leaf mass per area40.12 g/m2

Leaf size333 mm²

Leaf width9 mm

Plant height0.297 m

⚠ sources differ — AusTraits: 0.297 m · TRY: 0.393 m

Plant height max0.85 m

Plant height min0.06 m

Seed mass0.361 mg

⚠ sources differ — TRY: 0.361 mg · AusTraits: 0.206 mg · GIFT: 1.54 mg

Seed mass max4.72 mg

Seed mass min0.14 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnnnyyyn

Life spanannual

Lifespan years1 years

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate oblanceolate

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.74 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Podolepis canescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Dibenzylbutyrolactone lignans1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Yatein		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podolepis canescens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAB033296.1 ↗639 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACATGTAACTACTAGCGGGCAAATAGGGATTGAGCTACCGCTTGATCCCCGTTTGCCCTT …

Podolepis canescens gene for ITS1, 5.8S ribosomal RNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Podolepis canescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, N. Konishi, M. Ito & K. Kosuge. 1999. Asteraceae: chromosome numbers and karyotypes in the Australian Gnaphalieae and Plucheeae. Austral. Syst. Bot. 12: 781–802.

n 101×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — TURNER, B. L. 1967. Chromosome survey of Podolepis (Compositae-Inuleae). Austral. Jour. Bot. 15: 445-449.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.955 ↗

08Occurrence & distribution

Record type762 records

Wild obs. + sensor544

Museum / vouchered216

Cultivated / captive2

Origin

Native233

Introduced3

Range

Area of Occupancy AOO2 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 437≤1 km 41≤10 km 45>10 km 3

526 georeferenced · 18 without coordinates

Open the mapobservation + sensor544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 48≤1 km 30≤10 km 73>10 km 21

172 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence216

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	48
Mount Annan, AU	43
Museo Entomologico de Leonlocation not on record	34
Kew, GB	12
Canberra, AU	9
Hobart, AU	7
Stockholm, SE	5
LDlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Brisbane, AU	2
MeiseBGlocation not on record	2
University of Stellenboschlocation not on record	2
Christchurch, NZ	2
Armidale, AU	2
BGPAlocation not on record	2
Albuquerque, US	1
EL PASO, US	1
Parkville, AU	1
Kensington, AU	1
MAlocation not on record	1
Auckland, NZ	1

21 institutions · 181 of 216 vouchered records shown · 35 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Podolepis canescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)