Pododesmus macrochisma

(Deshayes, 1839) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Pectinida/Anomiidae/Pododesmus

At a glance

Occurrence records2 833

Data sources11

Biological traits5

DNA specimens27

eDNA detections25

Sources11 archives

Databases and archives Pododesmus macrochisma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 432 records↗

OBISOcean Biodiversity Information System401 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS2 833 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceGoaT · NCBI≈767 Mbp

01Narrative

Pododesmus macrochisma, common name the green falsejingle or the Alaska jingle, is a species of saltwater clam, a marine bivalve mollusc in the family Anomiidae, the jingle shells. This species inhabits the northwest Sea of Japan, and more specifically, the coast of the South Primorye at Hokkaido Island, the northern part of Honshu Island, off the southern and eastern Sakhalin in the Kuril Islands, and in the east of Kamchatka in the Commander and Aleutian Islands. More recently it has been found in the Chukchi Sea near Alaska, potentially due to global warming.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max30 m

Depth min0 m

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pododesmus macrochisma has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes2

eDNA detections25

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Diversity (π)2.3%

Haplotypes1

BIN1

Where individuals differ — all 97 variable positions, in barcode order

499Tmostly conserved

500Amostly conserved

501Gmostly conserved

502Tmostly conserved

503Gmostly conserved

505Tmostly conserved

506Amostly conserved

508Cmostly conserved

509Tmostly conserved

511Cmostly conserved

512Tmostly conserved

515Cmostly conserved

517Tmostly conserved

519Cmostly conserved

520Tmostly conserved

521Cmostly conserved

522Amostly conserved

523Tmostly conserved

524Amostly conserved

525Cmostly conserved

526Tmostly conserved

529Cmostly conserved

530Tmostly conserved

531Cmostly conserved

532Tmostly conserved

534Cmostly conserved

536Tmostly conserved

537Gmostly conserved

538Tmostly conserved

539Amostly conserved

540Tmostly conserved

542Gmostly conserved

544Cmostly conserved

545Amostly conserved

546Gmostly conserved

552Tmostly conserved

554Amostly conserved

556Cmostly conserved

557Amostly conserved

559Tmostly conserved

560Amostly conserved

561Tmostly conserved

563Gmostly conserved

564Cmostly conserved

565Tmostly conserved

567Amostly conserved

568Tmostly conserved

569Amostly conserved

570Gmostly conserved

571Amostly conserved

572Cmostly conserved

574Gmostly conserved

576Cmostly conserved

577Amostly conserved

578Tmostly conserved

582Gmostly conserved

584Tmostly conserved

585Amostly conserved

586Cmostly conserved

587Tmostly conserved

589Cmostly conserved

591Tmostly conserved

592Amostly conserved

593Tmostly conserved

597Gmostly conserved

598Amostly conserved

599Tmostly conserved

600Cmostly conserved

602Tmostly conserved

603Gmostly conserved

604Cmostly conserved

605Tmostly conserved

606Gmostly conserved

611Tmostly conserved

612Gmostly conserved

614Tmostly conserved

615Gmostly conserved

616Amostly conserved

617Tmostly conserved

618Cmostly conserved

620Amostly conserved

621Gmostly conserved

622Tmostly conserved

623Cmostly conserved

624Tmostly conserved

626Amostly conserved

627Tmostly conserved

630Amostly conserved

631Tmostly conserved

632Amostly conserved

633Cmostly conserved

634Amostly conserved

635Cmostly conserved

636Tmostly conserved

638Amostly conserved

639Tmostly conserved

641Cmostly conserved

TCGGATTTTGGGCTGCCCTAGGAGGGTGAAGGTTAAGGGTTATAATTCGCCTGGAGATAGGGCGTCCTGGGTTATGGCTTGGCGGTGCCC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pododesmus macrochisma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈766 574 093 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pododesmus macrochisma0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 833 records

Wild obs. + sensor2 035

Museum / vouchered497

Fossil268

Other33

Range

Area of Occupancy AOO3 760 km²

Depth

0–200 m sunlit98

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 14 m · max 349 m · 99 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 951≤1 km 530≤10 km 49>10 km 38

1 568 georeferenced · 467 without coordinates

Open the mapobservation + sensor2 035

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤1 km 35≤10 km 54>10 km 14

103 georeferenced · 394 without coordinates

Open the institutions mapphysical evidence497

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	73
Victoria, CA	62
CASlocation not on record	33
Cambridge, US	29
Delaware Museum of Nature and Sciencelocation not on record	28
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	25
Philadelphia, US	22
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	15
National Marine Biodiversity Institute of Korealocation not on record	8
Chongqing Museumlocation not on record	8
Denver, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
P. P. Shirshov Institute of Oceanologylocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
Washington, US	3
Florida Museum of Natural Historylocation not on record	3
Helsinki, FI	3
UM-RSMASlocation not on record	3
University of Victorialocation not on record	2
Los Angeles, US	2
Chicago, US	1
Paleontological Research Institutionlocation not on record	1
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	1
Edmonton, CA	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Seattle, US	1
Saint John, CA	1

28 institutions · 348 of 497 vouchered records shown · 8 without an institution code

09Environmental DNA25 detections

Where the DNA of Pododesmus macrochisma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

Rhabdocalyptus dawsoni reef, bedrock wallrocky shore, intertidalseagrass bedsoft sedimentrock scarp/wallboulder field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 6.00–14.1

Seasonal swing summer↔winter11.0 °C

Max temp (day)12.7 °C 8.40–16.9

Min temp (night)9.20 °C 2.90–12.1

Precipitation165 mm/mo 62.6–209

Air humidity64.1 % 62.0–68.5

Moisture balance95.5 mm/mo

Vapour deficit485 Pa 343–524

Wind speed4.60 m/s

Cloud cover40.2 % 37.6–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pododesmus macrochisma

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 833 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 833 records