Podocarpus totara

G.Benn. ex D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Podocarpus

At a glance

Occurrence records7 331

Data sources15

Biological traits42

DNA specimens17

eDNA detections15

Sources15 archives

Databases and archives Podocarpus totara's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources42 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF7 331 records

Environmental DNA1 datasets · 0 countries15 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB · GoaT11 Gbp

01Narrative

Podocarpus totara (; from the Maori-language ; the spelling "totara" is also common in English) is a species of podocarp tree endemic to New Zealand. It grows throughout the North Island and northeastern South Island in lowland, montane and lower subalpine forest at elevations of up to 600 m. Tōtara is commonly found in lowland areas where the soil is fertile and well drained.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length6 mm

Fruit width4 mm

Leaf length max22 mm

Leaf width3 mm

Leaf width max3 mm

Leaf width min3 mm

Plant height6 m

Plant height max30 m

Seed length4 mm

Seed length max4 mm

Seed length min4 mm

Seed mass20 mg

Seed mass max20 mg

Seed mass min20 mg

Seed width3 mm

Seed width max3 mm

Seed width min3 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Lifespan years500 years

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)431 mg/g

Leaf n9.4 mg/g

Leaf p2.06 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.64 mm²/mg

Wood density449 mg/cm³

03Chemical composition19 compounds

Compounds documented for Podocarpus totara across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthocyanidins6

Totarane diterpenoids4

Guaiane sesquiterpenoids3

Stigmastane steroids2

Podocarpane diterpenoids2

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Totarol	present	LOTUS
(1S,4S,8R,9S,12R,15R)-4,8,12,15-tetramethyl-14-methylidenetetracyclo[7.6.0.01,12.04,9]pentadecane	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S,6R)-2-[5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)chromenylium-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(3S,3aS,5R,8R,9aR,9bR)-5,8-dihydroxy-3,6-dimethyl-9-methylidene-3,3a,4,5,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aS,6aR,8R,9aR,9bS)-8-hydroxy-3-methyl-6,9-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
(4bR,8S,8aR)-8-(hydroxymethyl)-4b,8-dimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-2-ol	present	LOTUS
(4bS,8aS)-3-[(4bS,8aS)-2-hydroxy-4b,8,8-trimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-3-yl]-4b,8,8-trimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-2-ol	present	LOTUS
16-Hydroxytotarol	present	LOTUS
2-[2-[2-(3,4-Dihydroxyphenyl)-5,7-dihydroxychromenylium-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
6,7-Dehydroferruginol	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podocarpus totara has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes3

GenBank sequences10

eDNA detections15

The DNA barcodea real sequence read deposited for this species

rbcLKF714206.1 ↗607 bp

ACGT

AAGTGCTGGGTTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGC …

Podocarpus totara isolate P580 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Podocarpus totara carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size11 002 500 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Podocarpus totara11 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–342n range34median34mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 346×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — Davies, B. J., I. E. W. O'Brien & B. G. Murray. 1997. Karyotypes, chromosome bands and genome size variation in New Zealand endemic gymnosperms. Pl. Syst. Evol. 208: 169–185.

CCDB · ipcn-api-dl — Murray, B. G., N. Friesen & J. S. Heslop-Harrison. 2002. Molecular cytogenetic analysis of Podocarpus and comparison with other gymnosperm species. Ann. Bot. (Oxford) 89: 483–489.

n 171×CCDB · Cave1958

CCDB · Cave1958 — Hair & Beuzen. '58a,b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 331 records

Wild obs. + sensor6 877

Museum / vouchered443

Cultivated / captive8

Fossil3

Origin

Native124

Introduced5

Range

Area of Occupancy AOO12 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 4 895≤1 km 688≤10 km 166>10 km 100

5 849 georeferenced · 1 028 without coordinates

Open the mapobservation + sensor6 877

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 8≤1 km 16≤10 km 12>10 km 3

39 georeferenced · 404 without coordinates

Open the institutions mapphysical evidence443

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 5 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	200
Wellington, NZ	93
Palmerston North, NZ	33
Auckland, NZ	31
University of Arizona, Laboratory of Tree-Ring Researchlocation not on record	13
Kew, GB	10
Hobart, AU	5
LDlocation not on record	4
New Zealand Arthropod Collectionlocation not on record	4
Moscow State Universitylocation not on record	4
Smithfield, AU	3
Armidale, AU	3
John T. Waterhouse Herbariumlocation not on record	3
Canberra, AU	2
Claremont, US	2
Wlocation not on record	2
Honolulu, US	2
Mount Annan, AU	2
South Kensington, GB	2
Canadian Department of Agriculturelocation not on record	2
Uppsala, SE	1
Rotorua, NZ	1
Bronx, US	1
College of the Atlantic, Museumlocation not on record	1
HAWlocation not on record	1
University of Alberta Museumslocation not on record	1
Chicago, US	1
Saint Louis, US	1
Parkville, AU	1
China Agricultural Universitylocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Riverside, US	1
San Jose, US	1
Vancouver, CA	1
MAlocation not on record	1
Santiago de Compostela, ES	1

37 institutions · 437 of 443 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Podocarpus totara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Podocarpus totara

At a glance

Sources15 archives

Size & morphology17

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry7

Compound class profile5 classes

Documented compounds19 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type7 331 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type7 331 records