Podocarpus spinulosus

(Sm.) R.Br. ex Mirb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Podocarpus

At a glance

Occurrence records930

Data sources9

Biological traits30

DNA specimens10

eDNA detections10

Sources9 archives

Databases and archives Podocarpus spinulosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF930 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Podocarpus spinulosus — вид хвойних рослин родини подокарпових.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Fruit length5 mm

Fruit width3 mm

Leaf length40 mm

Leaf length max80 mm

Leaf width3 mm

Leaf width max3 mm

Plant height3 m

Seed length11.5 mm

Seed width8.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Lifespan years100 years

Pollination syndromeabiotic

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Podocarpus spinulosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pimarane and Isopimarane diterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
ent-Sandaracopimaradiene		present	LOTUS
Pimara-8(14),15-diene		present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podocarpus spinulosus has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections10

The DNA barcodea real sequence read deposited for this species

ITSKF714000.1 ↗425 bp

ACGT

TGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCTCCGGCCGAGGGCACGTCTGCCTGGGCGACGCACTTTCG …

Podocarpus spinulosus isolate P560 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type930 records

Wild obs. + sensor619

Museum / vouchered296

Cultivated / captive3

Other12

Origin

Native110

Introduced2

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 470≤1 km 49≤10 km 12>10 km 5

536 georeferenced · 83 without coordinates

Open the mapobservation + sensor619

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 30≤1 km 61≤10 km 114>10 km 29

234 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence296

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	111
Brisbane, AU	46
Canberra, AU	44
Museo Entomologico de Leonlocation not on record	23
Kew, GB	20
Armidale, AU	10
Adelaide, AU	9
John T. Waterhouse Herbariumlocation not on record	4
Smithfield, AU	4
Wollongong, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Kensington, AU	2
Hobart, AU	2
Moscow State Universitylocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Parkville, AU	1
James Cook Townsvillelocation not on record	1
Auckland, NZ	1
Saint Louis, US	1
Canadian Department of Agriculturelocation not on record	1
Honolulu, US	1
South Kensington, GB	1

22 institutions · 290 of 296 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Podocarpus spinulosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)