Podocarpus smithii

de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Podocarpus

At a glance

Occurrence records187

Data sources8

Biological traits21

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Podocarpus smithii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Podocarpus smithii é uma espécie de conífera da família Podocarpaceae. Apenas pode ser encontrada na Austrália.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length27.5 mm

Fruit width21 mm

Leaf length85 mm

Leaf width10 mm

Plant height30 m

Seed length15 mm

Seed width11 mm

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typestrobilus

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Podocarpus smithii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pimarane and Isopimarane diterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
ent-Sandaracopimaradiene		present	LOTUS
Pimara-8(14),15-diene		present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podocarpus smithii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSKF713997.1 ↗425 bp

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCGAGGGCACGTCTGCCTGGGCGACGCACCTTCG …

Podocarpus smithii isolate P552 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor3

Museum / vouchered172

Other12

Origin

Native8

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 12≤1 km 19≤10 km 40>10 km 7

78 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	79
Brisbane, AU	32
Canberra, AU	13
Mount Annan, AU	8
Kew, GB	7
Palmerston, AU	7
Honolulu, US	7
Taipei, TW	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Saint Louis, US	1
ASUlocation not on record	1

12 institutions · 160 of 172 vouchered records shown · 12 without an institution code

09Environmental DNA6 detections

Where the DNA of Podocarpus smithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)