Podocarpus sellowii

Klotzsch ex Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Podocarpus

At a glance

Occurrence records472

Data sources11

Biological traits14

DNA specimens9

eDNA detections9

Sources11 archives

Databases and archives Podocarpus sellowii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS72 compounds

Occurrence & distributionGBIF472 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Podocarpus sellowii is a species of conifer in the family Podocarpaceae. It is found only in Brazil. Adult tree (center)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max15 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min500 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista, Restinga

Woodinesswoody

03Chemical composition72 compounds

Compounds documented for Podocarpus sellowii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids7

Nagilactone diterpenoids6

Cinnamic acids and derivatives5

Spirostane steroids4

Ergostane steroids3

Documented compounds72 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4R,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol	present	NPASS
(1R,2R,4R,5R,8S,11R,13S,14S,15R,16S,19S,22S,23R,25S)-2,19-dihydroxy-13,16,23-trimethyl-6,10,17,26,27,30-hexaoxanonacyclo[23.2.2.15,14.15,15.01,23.04,22.08,13.011,16.015,19]hentriacont-28-ene-9,18,24,31-tetrone	present	NPASS
(1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-10,16-diol	present	NPASS
(1S,2R,4R,5R,10S,12S,14R,15R,18R)-5-[(2R)-1-hydroxypropan-2-yl]-10,15-dimethyl-3,6,13,17-tetraoxahexacyclo[8.7.1.02,4.04,9.012,14.015,18]octadec-8-ene-7,16-dione	present	LOTUS
(1S,2R,4R,5S,6R,9S,10R,17R)-5,10-dihydroxy-1,6-dimethyl-12-propan-2-yl-3,8,13-trioxapentacyclo[7.7.1.02,4.06,17.011,16]heptadeca-11,15-diene-7,14-dione	present	LOTUS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-10-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(6'S)-beta,epsilon-carotene	present	NPASS
2-Propenoic acid, 3-(4-hydroxy-3-methoxyphenyl)-, ethyl ester	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podocarpus sellowii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF714191.1 ↗607 bp

ACGT

AAGTGTTTTTTTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGC …

Podocarpus sellowii isolate P549 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type472 records

Wild obs. + sensor12

Museum / vouchered449

Other11

Origin

Native182

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤1 km 1>10 km 11

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 3>10 km 4

9 georeferenced · 440 without coordinates

Open the institutions mapphysical evidence449

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 74 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Jose State University, Museum of Birds and Mammalslocation not on record	60
Bronx, US	42
Blumenau, BR	33
USP-IBlocation not on record	27
Ivano-Frankivsk, UA	17
Frankfurt am Main	14
Stockholm, SE	13
Porto Alegre, BR	12
JBRJlocation not on record	12
Salvador, BR	9
Laboratorio de Ictiologialocation not on record	9
Brasília, BR	8
Feira de Santana, BR	8
UFBAlocation not on record	8
UFPRlocation not on record	8
Masindi, UG	7
Universidade Federal de Sergipe (UFS)location not on record	7
Chaguaramas, TT	6
UNICAMPlocation not on record	6
INMAlocation not on record	6
Pontifícia Universidade Católica do Paranálocation not on record	6
UNESClocation not on record	6
Seropédica, BR	5
UTFPR-CPlocation not on record	5
Bogotá, D.C., CO	5
UFRRJlocation not on record	5
CEPLAClocation not on record	5
University of Stellenboschlocation not on record	5
UNESP-FCAlocation not on record	4
Istituto Agrario Castelnuovolocation not on record	4
Université de Bordeauxlocation not on record	4
Instituto do Meio Ambientelocation not on record	4
IPA/SPlocation not on record	3
UFSClocation not on record	3
UFMGlocation not on record	3
Campo Mourão, BR	3
UNIVILLElocation not on record	3
Criciúma, BR	3
UFPElocation not on record	3
Saint Louis, US	3
Fortaleza, BR	3
Universidade Federal do Ceara, Departamento de Biologialocation not on record	3
UFSJlocation not on record	2
Auckland, NZ	2
Kew, GB	2
UNIVASFlocation not on record	2
Departamento de Sistematica e Ecologialocation not on record	2
Universidade Federale do Rio Grande do Sullocation not on record	2
Cenargenlocation not on record	2
UEMlocation not on record	2
UNISANTAlocation not on record	2
ESALQlocation not on record	2
Foz do Iguaçu, BR	2
Universidade da Região de Joinville - Univillelocation not on record	2
Universidade Paulistalocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Porto Velho, BR	2
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	1
Cuiabá, BR	1
Institut fur Allgemeine Mikrobiologielocation not on record	1
UnBlocation not on record	1
Brasília, BR	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Ann Arbor, US	1
Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Canadian Department of Agriculturelocation not on record	1
FPMZBlocation not on record	1
Universidade de São Paulolocation not on record	1
Ilhéus, BR	1
Federal University of Espírito Santolocation not on record	1
UFESlocation not on record	1
FUVATESlocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1

74 institutions · 447 of 449 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Podocarpus sellowii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)