Podisus placidus

Uhler, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Podisus

At a glance

Occurrence records437

Data sources7

Biological traits0

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Podisus placidus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility437 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF437 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 16

01Narrative

Podisus placidus is a species of predatory stink bug in the family Pentatomidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podisus placidus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)2.9%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 53 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

5Tmostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

12Tmostly conserved

13Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Gmostly conserved

35Amostly conserved

36Tmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

44Tmostly conserved

45Cmostly conserved

47Gmostly conserved

48Cmostly conserved

49Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Amostly conserved

56Tmostly conserved

57Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Avariable

69Tmostly conserved

71Gmostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

79Tmostly conserved

139Tvariable

271Cmostly conserved

355Tvariable

358Cvariable

574Cmostly conserved

578Tvariable

AACTTTATACTTTATATTTGGAATATGAGCGGGAATAGTAGGATCAGCTATAAGATTAATTATTCGAATTGAATTAGGTCAACCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arma chinensissame family10.6%Arma custossame family10.8%Jalla dumosasame family10.8%Troilus luridussame family11.0%Thyanta accerrasame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Podisus placidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type437 records

Wild obs. + sensor324

Museum / vouchered113

Range

Area of Occupancy AOO1 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 155≤1 km 68≤10 km 29>10 km 34

286 georeferenced · 38 without coordinates

Open the mapobservation + sensor324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 8≤10 km 48>10 km 5

61 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	35
New Haven, US	25
University of Guelphlocation not on record	14
Royal Saskatchewan Museumlocation not on record	10
Champaign, US	8
Chicago, US	7
University of Central Floridalocation not on record	2
Cambridge, US	1
College Station, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Washington, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
St. Paul, US	1

14 institutions · 108 of 113 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Podisus placidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

GrassBush, prairie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 14.7–20.7

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 17.6–25.7

Min temp (night)15.0 °C 12.4–16.6

Precipitation90.3 mm/mo 85.2–112

Air humidity59.0 % 57.3–62.4

Moisture balance-47.1 mm/mo

Vapour deficit888 Pa 631–1,022

Wind speed3.10 m/s

Cloud cover41.5 % 39.3–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)