Poa pratensis
speciesAt a glance
Occurrence records651 185
Data sources15
Biological traits151
DNA specimens312
eDNA detections107
Sources15 archives
Databases and archives Poa pratensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility651 185 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics312 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources151 traits
Occurrence & distributionGBIF651 185 records
Environmental DNA1 datasets · 17 countries107 detections
DNA & barcodingBOLD · NCBI312 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex4.6 Gbp
01Narrative
Le pâturin des prés est une plante herbacée vivace très commune de la famille des Poaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Inflorescence length max16 cm
Inflorescence length min4 cm
Leaf length248 mm
Leaf length max150 mm
Leaf length min50 mm
Leaf mass42.24 mg
Leaf size567 mm²
⚠ sources differ — TRY: 567 mm² · LEDA: 872 mm² · GIFT: 1 025 mm²
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 3 mm
Leaf width max4 mm
Leaf width min2 mm
Plant height0.353 m
⚠ sources differ — GIFT: 0.353 m · AusTraits: 0.9 m · LEDA: 0.3 m · USDA: 0.549 m · TRY: 0.309 m
Plant height generative0.607 m
Plant height max1.2 m
Plant height min0.1 m
Seed length1.39 mm
⚠ sources differ — TRY: 1.39 mm · GIFT: 1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.277 mg
⚠ sources differ — TRY: 0.277 mg · LEDA: 0.255 mg · GIFT: 6.82 mg
Seed mass max0.52 mg
Seed mass min0.14 mg
Seed volume0.25 mm³
Seed volume max0.27 mm³
Seed volume min0.23 mm³
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction39
After harvest regrowth rateModerate
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colouryellow
Flower conspicuousNo
Flower length max3.5 mm
Flower length min2.5 mm
Flowering endJun
Flowering startMay
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodYes
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityresprouts
Seed number68 147
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSpring and Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 400 m
Elevation mean2 250 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Leaf shapelinear
Low growing grassYes
Mycorrhiza typeAMNM
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceMedium
Frost free days min110 days
Leaf C:N ratio28.08 g/g
Leaf c440 mg/g
Leaf dry-matter content (LDMC)336 mg/g
⚠ sources differ — TRY: 336 mg/g · LEDA: 304 mg/g
Leaf n19.65 mg/g
Leaf p1.75 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max62.5 in
Precipitation min26 in
Protein potentialMedium
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max8.2 pH
Soil pH min5.5 pH
Specific leaf area (SLA)19.27 mm²/mg
⚠ sources differ — TRY: 19.27 mm²/mg · LEDA: 19.7 mm²/mg · GIFT: 21.29 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 389 840 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Planting density max43 560 per acre
Planting density min43 560 per acre
Seeds per fruit101-1000
05DNA & barcoding312 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Poa pratensis has left across the world's sequence archives.
At a glance
DNA specimens312
Marker genes14
GenBank sequences10
eDNA detections107
Countries18
The DNA barcodea real sequence read deposited for this species
AGACCGCGCACGCGTCATCCAGCCTGCCGGCGGCGGCACCGTTCGTCGCTCGGCCAAGTCCTCGATAACCTCCTCTCCTCGGAGTGGGGG …
Poa pratensis isolate guo6T internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★trnL-F★ITS10★ITS1★ITS2atpF-atpHcp-trnL-intronpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_077587 ↗ · 35 protein · 21 tRNA · 8 rRNA
nad5nad1matRrps1ccmFNrps4nad3rps12ccmBmttBnad7atp8nad4nad4Lnad6rps2atp6rps7rps3rpl16cox3sdh4atp1atp4ccmCcox2+11
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Poa pratensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 621 050 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Poa pratensis4.62 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 56 n = 28
Ploidypolyploid inferred
Chromosome records14–1062n range56median56mode152records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5641×GoaT · Tree of Sex Database · CCDB · iapt · CCDB · book-ipcn65 +5
GoaT · Tree of Sex Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iapt
CCDB · book-ipcn65 — Bowden in B. & L. 1960
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Dijk, G. E. v. & G. D. Winkelhorst. 1982. Interspecific crosses as a tool in breeding Poa pratensis L. 1. Poa longifolia Trin. x P. pratensis L. Euphytica 31: 215–223.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · book-ipcn75-78 — Chopanov & Yurtsev 1976
CCDB · book-indian_vol2 — Delay, C. 1947 ; Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov) ; Tateoka, T. 1953 ; Sokolovskaya, A.P. (Fedorov)
CCDB · CromoCat 2015 — Armstrong, J. M. (1937). A cytological study of the genus Poa. Canad. J. Res. 15: 281-297.
CCDB · CromoCat 2015 — Avdulov, N. P. (1931). Karyo-systematische Untersuchungen der Familie Gramineen. Bull. Appl. Bot., Genet. & Plant Breeding Suppl. 43: 1-438.
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Brittingham, W. H. (1941). An artificial hybrid between two species of bluegrass: Canada bluegrass (Poa compressa L.) and Kentucky bluegrass (P. pratensis L.). J. Heredity 32: 57-63.
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
CCDB · CromoCat 2015 — Brown, W. L. (1941). The cytogenetics of Poa pratensis. Ann. Missouri Bot. Gard. 28: 493-522.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Enushchenko, I. V. & Chepinoga, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Chopanov, P. & Yurtsev, B. (1976). Chromosome numbers of some grasses of Turkmenia. II. Bot. Žurn. 61: 1240-1244.
CCDB · CromoCat 2015 — Church, G. L. (1936). Cytological studies in the Gramineae. Amer. J. Bot. 23: 12-15.
CCDB · CromoCat 2015 — Delay, C. (1947b). Recherches sur la structure des noyaux quiescents chez les Phanérogames. Rev. Cytol. et Cytophysiol. Vég. 10(1-4): 103-229.
CCDB · CromoCat 2015 — Dijk, G. E. van & Winkelhorst, G. D. (1982). Interspecific crosses as a tool in breeding Poa pratensis L. 1. Poa longifolia Trin. x P. pratensis L. Euphytica 31: 215-223
CCDB · CromoCat 2015 — Guzik, M. B. (1984). Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82-86
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
CCDB · CromoCat 2015 — Moriya, A. & A. Kondo. (1950a). Cytological studies of forage plants. I. Grasses. Jap. J. Genet. 25: 126-131.
CCDB · CromoCat 2015 — Nielsen, E. L. (1946). Breeding behavior and chromosome numbers in progenies from twin and triplet plants of Poa pratensis. Bot. Gaz. 106: 26-40.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
CCDB · CromoCat 2015 — Probatova, N. S. & Seledets, V. P. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
CCDB · CromoCat 2015 — Probatova, N. S., Korobkov, A. A, Gnutikov, A. A., Rudyka, E. G., Kotseruba, V. V. & Seledets, V. P. (2010). IAPT/IOPB chromosome data 10 Taxon 59 (6): 1935-1937
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P., Gnutikov, A. A. & Shatokhina, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Rozanova, M. A. (1940a). O biologichskoy izolyatsii i skritich vidach. Bot. Žurn. 25: 304-308.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1968). A karyosystematic investigation of the far eastern species of Poa L. Bot. Žurn. 53: 1737-1743.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1973). Karyosystematic investigations of the far east species of Poa L. Bot. Žurn. 58: 89-96.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & O. S. Strelkova. (1940). Karyological investigation of the alpine flora on the main Caucasus range and the problem of geographical distribution of polyploids. Dokl. Akad. Nauk. SSSR. 29: 415-418.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & O. S. Strelkova. (1948a). Geograficheskoye raspredelenie poliploidov. II. Issledovanie flory Altaya. Ucen. Zap. Leningradsk. Gosud. Univ., Ser. Biol. Nauk. 66: 179-193.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. (1960). Geograficheskoye rasprostraneny poliploidnich vidov rasteny (issledovanie flory o. Sakhalina). Vestn. Leningr. Univ. Ser. Biol. 21: 42-58.
CCDB · CromoCat 2015 — Stählin, A. (1929). Morphologische und zytologische untersuchungen an Gramineen. I-II. Wiss. Arch. Landwirtsch 1: 330-398.
CCDB · CromoCat 2015 — Tateoka, T. (1954a). Karyosystematic studies in Poaceae. I. Natl. Inst. Genet. (Japan), Ann. Rep. 4: 45-47.
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1980). A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zurn. 65 (4): 509-520.
CCDB · iapt — IAPT/IOPB Chromosome Data 33
+1 more references
2n 4221×GoaT · Tree of Sex Database · CCDB · slov-fl · CCDB · iapt +5
GoaT · Tree of Sex Database — ↗
CCDB · slov-fl — Uhríková A., 2007: [New records in Astragalus, Caltha, Cerastium, Dactylorhiza, Gagea, Genista, Geum, Knautia, Linaria, Lithospermum, Oryzopsis, Poa, Polygala, Sanguisorba, Scrophularia, Sorbus, and Vulpia], pp. 120, 140, 185, 221, 222, 272, 288, 293, 345, 371, 374, 424, 458, 460, 520, 533, 557, 558, 629. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · fl-europaea — Almgaard, 1960
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zheng, F. h. Xue, J. f. Yun, L. y. Wang & X. q. Fu. 1995. The chromosome numbers of 35 forage species and their geographical distribution. Grassl. China 1995(1): 16–20.
CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1981. Chromosome studies in some Festuceae. J. Indian Bot. Soc. 60: 148–153.
CCDB · book-indian_vol2 — Almgard, G. 1960
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Brown, W. L. (1941). The cytogenetics of Poa pratensis. Ann. Missouri Bot. Gard. 28: 493-522.
CCDB · CromoCat 2015 — Flovik, K. (1938). Cytological studies of arctic grasses. Hereditas 24: 265-375.
CCDB · CromoCat 2015 — Ghorai, A. & Sharma, A. (1981). Chromosome studies in some Festuceae Journal of the Indian Botanical Society 60: 148-153
CCDB · CromoCat 2015 — Grober, K. , Matzk, F. & Zacharias, M. (1978). III. Beziehungen zuischen apomiRtischer bsw. amphimiktischer Samenausbildung vegetativer Leistung und Chromosomenzahl bei Poa pratensis L. Kulturpflanze 26: 303-327.
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
CCDB · CromoCat 2015 — Müntzing, A. (1937a). Polyploidy from twin seedlings. Cytologia Fujii Jub.: 211-2
CCDB · CromoCat 2015 — Radeloff, H. (1930). Zur unterscheidung der spelzfrüchte unserer wichtigsten Festuca und Poa arten unter besonderer berücksichtigung ihrer mikroskopie. Proc. Inter. Seedtest Ass. 11-12: 1-107.
CCDB · CromoCat 2015 — Stoeva, M. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 579-580.
CCDB · CromoCat 2015 — Stoeva, M. P. (1984). Populacionna izmencivost v Poa compressa L. i Poa pratensis L. V. Savremenni tcoreticni i prilozni aspekti na rastiteinata ekologija 1: 268-275.
CCDB · CromoCat 2015 — Yan, G. -X., S. -Z. Zheng, F. -H. Xue, J. -F. Yun, L. -Y. Wang & X. -Q. Fu (1995). The chromosome numbers of 35 forage species and their geographical distribution. Grassland China 4:53-60
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1980). A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zurn. 65 (4): 509-520.
TreeOfSex · plant — Goldblatt1979 ↗
2n 7016×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
CCDB · book-indian_vol2 — Nakajima, G. 1933 ; Sokolovskaya, A.P. (Fedorov)
CCDB · CromoCat 2015 — Avdulov, N. P. (1931). Karyo-systematische Untersuchungen der Familie Gramineen. Bull. Appl. Bot., Genet. & Plant Breeding Suppl. 43: 1-438.
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Christov, M. (1944). Die polyembryonie als Ursache für die variabilitat in den apomiktischen arten der gattung Poa. Ann. Univ. Sofia, Fac. Agr. & Sylvic. 22: 153-179.
CCDB · CromoCat 2015 — Cox, L. M. & Clausen, J. (1955). Chromosome numbers of hybrid Poa lines. Carnegie Inst. Wash. Year Book 54: 175-177.
CCDB · CromoCat 2015 — Grun, P. & Triplett, E. L. (1952). Poa cytology. Carnegie Inst. Wash. Year Book 51: 119-122.
CCDB · CromoCat 2015 — Grun, P. (1954). Cytogenetic studies of Poa. I. Chromosome numbers and morphology of interspecific hybrids. Amer. J. Bot. 41: 671-678.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1942b). Cytotaxonomic studies on boreal plants. I. Some observations on Swedish and Icelandic plants. Kungl. Fysiogr. Sällsk. Lund Förhandl. 12: 1-19.
CCDB · CromoCat 2015 — Nakajima, G. (1933). Chromosome numbers in some Angiosperms. Jap. J. Genet. 9: 1-5.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1973). Karyosystematic investigations of the far east species of Poa L. Bot. Žurn. 58: 89-96.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & O. S. Strelkova. (1940). Karyological investigation of the alpine flora on the main Caucasus range and the problem of geographical distribution of polyploids. Dokl. Akad. Nauk. SSSR. 29: 415-418.
CCDB · CromoCat 2015 — Tinney, F. W. (1940). Cytology of parthenogenesis in Poa pratensis. J. Agric. Res. 60: 351-360.
CCDB · CromoCat 2015 — Zhukova, P. G. & A. D. Tikhonova. (1973). The chromosome numbers of some Chukotka plant species. II. Bot. Žurn. 58: 395-402.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 509-511.
TreeOfSex · plant — Goldblatt1979 ↗
2n 2813×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +2
CCDB · iapt
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · book-indian_vol2 — Stoeva, M.P. 1977
CCDB · eflora
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Avdulov, N. P. (1928). Systematicheskaya kariologiya semeestva Gramineae. Drievnik vsesojuznogo Sezda Bot. Leningrade 1928: 65-66.
CCDB · CromoCat 2015 — Avdulov, N. P. (1931). Karyo-systematische Untersuchungen der Familie Gramineen. Bull. Appl. Bot., Genet. & Plant Breeding Suppl. 43: 1-438.
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Christov, M. (1942). Embriologische Studien der Fortpflanzung einiger Poa Arten. Ann. Univ. Sofia, Fac. Agr. & Sylvic. 20: 169-187.
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
CCDB · CromoCat 2015 — Nielsen, E. L. (1945). Cytology and breeding behavior of selected plants of Poa pratensis. Bot. Gaz. 106: 357-382.
CCDB · CromoCat 2015 — Stoeva, M. P. (1984). Populacionna izmencivost v Poa compressa L. i Poa pratensis L. V. Savremenni tcoreticni i prilozni aspekti na rastiteinata ekologija 1: 268-275.
CCDB · CromoCat 2015 — Stoeva, M. P. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 560.
2n 8411×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 +3
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-indian_vol2 — Taylor, R.L. & Mulligan, G.A. 1968
CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Grun, P. (1951a). Poa cytology. Carnegie Inst. Wash. Year Book 50: 111-112.
CCDB · CromoCat 2015 — Grun, P. (1955). Cytogenetic studies of Poa. II. The pairing of chromosomes inspecies and interspecific hybrids. Amer. J. Bot. 42: 11-18.
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
CCDB · CromoCat 2015 — Stoeva, M. P. (1984). Populacionna izmencivost v Poa compressa L. i Poa pratensis L. V. Savremenni tcoreticni i prilozni aspekti na rastiteinata ekologija 1: 268-275.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
2n 497×GoaT · Tree of Sex Database · CCDB · CromoCat 2015 · TreeOfSex · plant
GoaT · Tree of Sex Database — ↗
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
CCDB · CromoCat 2015 — Grober, K. , Matzk, F. & Zacharias, M. (1978). III. Beziehungen zuischen apomiRtischer bsw. amphimiktischer Samenausbildung vegetativer Leistung und Chromosomenzahl bei Poa pratensis L. Kulturpflanze 26: 303-327.
CCDB · CromoCat 2015 — Hartung, M. E. (1946). Chromosome numbers in Poa, Agropyron and Elymus. Amer. J. Bot. 33: 516-531.
CCDB · CromoCat 2015 — Stoeva, M. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 579-580.
CCDB · CromoCat 2015 — Stoeva, M. P. (1984). Populacionna izmencivost v Poa compressa L. i Poa pratensis L. V. Savremenni tcoreticni i prilozni aspekti na rastiteinata ekologija 1: 268-275.
TreeOfSex · plant — Goldblatt1979 ↗
2n 635×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · CromoCat 2015 — Christov, M. (1944). Die polyembryonie als Ursache für die variabilitat in den apomiktischen arten der gattung Poa. Ann. Univ. Sofia, Fac. Agr. & Sylvic. 22: 153-179.
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1988). SOCGI plant chromosome number reports -- VI Journal of Cytology and Genetics 23: 38-52
CCDB · CromoCat 2015 — Stoeva, M. P. (1984). Populacionna izmencivost v Poa compressa L. i Poa pratensis L. V. Savremenni tcoreticni i prilozni aspekti na rastiteinata ekologija 1: 268-275.
CCDB · CromoCat 2015 — Tinney, F. W. (1940). Cytology of parthenogenesis in Poa pratensis. J. Agric. Res. 60: 351-360.
2n 685×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Cox, L. M. & Clausen, J. (1955). Chromosome numbers of hybrid Poa lines. Carnegie Inst. Wash. Year Book 54: 175-177.
CCDB · CromoCat 2015 — Grun, P. & Triplett, E. L. (1952). Poa cytology. Carnegie Inst. Wash. Year Book 51: 119-122.
CCDB · CromoCat 2015 — Grun, P. (1951a). Poa cytology. Carnegie Inst. Wash. Year Book 50: 111-112.
CCDB · CromoCat 2015 — Grun, P. (1954). Cytogenetic studies of Poa. I. Chromosome numbers and morphology of interspecific hybrids. Amer. J. Bot. 41: 671-678.
CCDB · CromoCat 2015 — Grun, P. (1955). Cytogenetic studies of Poa. II. The pairing of chromosomes inspecies and interspecific hybrids. Amer. J. Bot. 42: 11-18.
2n 363×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · book-indian_vol2 — Mlintzing, A. 1940
CCDB · CromoCat 2015 — Müntzing, A. (1940). Further studies on apomixis and sexuality in Poa. Hereditas 26: 115-190.
2n 403×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Stepanov, N. V. 1992. Chromosome numbers in representatives of some families of higher plants. Bot. Žhurn. (Moscow & Leningrad) 77(2): 113–114.
CCDB · CromoCat 2015 — Kiellander, C. L. (1942). A subhaploid Poa pratensis L. with 18 chromosomes, and its progeny. Svensk Bot. Tidskr. 36: 200-220.
CCDB · CromoCat 2015 — Stepanov, N. V. (1992). Chromosome numbers in representatives of some families of higher plants Botani?eskij Žurnal (Moscow & Leningrad) 77(2): 113-114
2n 523×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015 · CCDB · iapt
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · CromoCat 2015 — Zhukova, P. G. & V. V. Petrovsky. (1976). Chromosome numbers of some western Chukotka plant species, II. Bot. Žurn. 61: 963-969.
CCDB · iapt — IAPT/IOPB Chromosome Data 32
2n 603×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · book-indian_vol2 — Zhukova, P.G. & Tikhonova, A.D. 1971
CCDB · CromoCat 2015 — Zhukova, P. G. & A. D. Tikhonova. (1971). Chromosome numbers of certain plant species indigenous to the Chukotsky province. Bot. Žurn. 56: 868-875.
2n 643×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Mehra, P.N. & Sunder, S. 1969
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
2n 663×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1981. Chromosome studies in some Festuceae. J. Indian Bot. Soc. 60: 148–153.
CCDB · CromoCat 2015 — Ghorai, A. & Sharma, A. (1981). Chromosome studies in some Festuceae Journal of the Indian Botanical Society 60: 148-153
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
2n 673×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Rancken, G. (1931). Eräiden nurmiheinälajien Kromosomeista. Tesis Helsinki
CCDB · CromoCat 2015 — Rancken, G. (1934). Zytologische Untersuchungen an einigen wirtschaftlich wertvollen Wiesengräsern. Acta Agr. Fennica 29: 1-94.
2n 743×CCDB · poland · CCDB · CromoCat 2015
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
2n 813×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Cox, L. M. & Clausen, J. (1955). Chromosome numbers of hybrid Poa lines. Carnegie Inst. Wash. Year Book 54: 175-177.
CCDB · CromoCat 2015 — Grun, P. & Triplett, E. L. (1952). Poa cytology. Carnegie Inst. Wash. Year Book 51: 119-122.
CCDB · CromoCat 2015 — Grun, P. (1954). Cytogenetic studies of Poa. I. Chromosome numbers and morphology of interspecific hybrids. Amer. J. Bot. 41: 671-678.
2n 903×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Fernandes, A. & Queiros, M. 1969
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
2n 142×GoaT · Tree of Sex Database · CCDB · CromoCat 2015
GoaT · Tree of Sex Database — ↗
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
2n 442×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. & Favarger, C. (1987). Contribution à la cytotaxonomie et a la cytogéographie des Poa (Poaceae = Gramineae) de la Suisse Denkschriften der Schweizerischen [Naturforschenden Gesellschaft] [Akademie der Naturwissenschaften] 100: 1-130
2n 502×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
2n 622×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1975
CCDB · CromoCat 2015 — Stoeva, M. P. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 560.
2n 722×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Sokolovskaya, A.P. (Fedorov)
CCDB · CromoCat 2015 — Kiellander, C. L. (1942). A subhaploid Poa pratensis L. with 18 chromosomes, and its progeny. Svensk Bot. Tidskr. 36: 200-220.
2n 752×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Grun, P. (1951a). Poa cytology. Carnegie Inst. Wash. Year Book 50: 111-112.
CCDB · CromoCat 2015 — Grun, P. (1955). Cytogenetic studies of Poa. II. The pairing of chromosomes inspecies and interspecific hybrids. Amer. J. Bot. 42: 11-18.
2n 912×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — LOve & LOve, 1942
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1942b). Cytotaxonomic studies on boreal plants. I. Some observations on Swedish and Icelandic plants. Kungl. Fysiogr. Sällsk. Lund Förhandl. 12: 1-19.
2n 982×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Christov & Nikolov
CCDB · CromoCat 2015 — Christov, M. & Nikolov, H. (1962). Kariologiceski i embriologiceski proucvanija varhu pokolenieto na edna poliploidna forma ot Poa pratensis. Izv. Centr. Naucnoizsl. Inst. Rasten. 15: 33-41.
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
2n 351×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Khoims, I. N. & Lebedeva, S. K. (1986). Evaluation of morphological characters biological properties and analysis of chromosome number in Kentucky grass specimens. Res. Bull. Vavilov Inst. Pl. Industr. 158: 45-49
2n 411×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
2n 431×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. & Favarger, C. (1987). Contribution à la cytotaxonomie et a la cytogéographie des Poa (Poaceae = Gramineae) de la Suisse Denkschriften der Schweizerischen [Naturforschenden Gesellschaft] [Akademie der Naturwissenschaften] 100: 1-130
2n 451×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Brown, W. L. (1939). Chromosome complements of five species of Poa with an analysis of variation in Poa pratensis. Amer. J. Bot. 26: 717-724.
2n 481×CCDB · book-northern-plants
CCDB · book-northern-plants — Nygren (unpubl.).
2n 531×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tinney, F. W. (1940). Cytology of parthenogenesis in Poa pratensis. J. Agric. Res. 60: 351-360.
2n 541×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tinney, F. W. (1940). Cytology of parthenogenesis in Poa pratensis. J. Agric. Res. 60: 351-360.
2n 581×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
2n 761×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Grun, P. (1951a). Poa cytology. Carnegie Inst. Wash. Year Book 50: 111-112.
2n 781×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1942b). Cytotaxonomic studies on boreal plants. I. Some observations on Swedish and Icelandic plants. Kungl. Fysiogr. Sällsk. Lund Förhandl. 12: 1-19.
2n 801×CCDB · poland
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
2n 861×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
2n 881×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bowden, W. M. (1961). Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe Festuceae: Poa and Puccinellia. Canad. J. Bot. 39: 123-138.
2n 1061×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Grun, P. (1955). Cytogenetic studies of Poa. II. The pairing of chromosomes inspecies and interspecific hybrids. Amer. J. Bot. 42: 11-18.
n 284×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1988). SOCGI plant chromosome number reports -- VI Journal of Cytology and Genetics 23: 38-52
CCDB · CromoCat 2015 — Spies, J. J., T. H. Burger & S. M. C. van Wyk (1999). Chromosome studies on African plants. 12. The tribes of subfamily Pooideae Bothalia 29(2): 335-341
TreeOfSex · plant — Goldblatt1979 ↗
n 143×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
n 72×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gohil, R. N. & K. K. Koul. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 155.
CCDB · CromoCat 2015 — Gohil, R. N. & Koul, K. K. (1986). SOCGI plant chromosome number reports -- IV. Journal of Cytology and Genetics 21: 155
n 212×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Spies, J. J., S. M. C. v. Wyk, I. C. Nieman & E. J. L. Liebenberg. 1997. Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The tribe Poeae. Bothalia 27: 75–82.
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1988). SOCGI plant chromosome number reports -- VI Journal of Cytology and Genetics 23: 38-52
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type651 185 records
Wild obs. + sensor586 635
Museum / vouchered57 683
Cultivated / captive3 733
Other3 134
Origin
Native43 642
Introduced1 118
Range
Area of Occupancy AOO643 548 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 116 835≤1 km 87 916≤10 km 232 882>10 km 3 399
441 032 georeferenced · 145 603 without coordinates
Open the mapobservation + sensor586 635
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 4 636≤1 km 11 365≤10 km 24 231>10 km 2 654
42 886 georeferenced · 14 797 without coordinates
Open the institutions mapphysical evidence57 683
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 873≤10 km 865>10 km 20
1 758 georeferenced · 1 975 without coordinates
Open the mapnot free-living3 733
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions265 of 499 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 27 050 |
| Moscow State Universitylocation not on record | 1 478 |
| Helsinki, FI | 1 387 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 946 |
| DBF-NHMDlocation not on record | 833 |
| Madison, US | 615 |
| Uppsala, SE | 542 |
| Bronx, US | 539 |
| BFLlocation not on record | 538 |
| BRNUlocation not on record | 511 |
| Victoria, CA | 509 |
| Olocation not on record | 493 |
| LDlocation not on record | 467 |
| Wuzhou, CN | 438 |
| University of Stellenboschlocation not on record | 424 |
| Salzburg, AT | 414 |
| Beijing, CN | 363 |
| International Salmonella Centre (W.H.O.)location not on record | 356 |
| Logan, US | 351 |
| Chicago, US | 325 |
| Oulu, FI | 324 |
| Chongqing Museumlocation not on record | 314 |
| Bergen, NO | 313 |
| Irkutsk State Universitylocation not on record | 311 |
| Québec, CA | 290 |
| Trondheim, NO | 290 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 283 |
| St. Paul, US | 280 |
| Université Lavallocation not on record | 275 |
| Nagano City, JP | 274 |
| Tartu, EE | 266 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 258 |
| Claremont, US | 256 |
| Denver, US | 241 |
| Albuquerque, US | 240 |
| Philadelphia, US | 236 |
| WTUlocation not on record | 235 |
| University of Alberta Museumslocation not on record | 235 |
| Berlin, DE | 222 |
| Adam Mickiewicz University in Poznańlocation not on record | 214 |
| Garðabær, IS | 211 |
| MeiseBGlocation not on record | 199 |
| Oregon State Universitylocation not on record | 197 |
| Uniwersytet Warszawskilocation not on record | 196 |
| Saint Louis, US | 185 |
| Moscow, US | 181 |
| Sanda, JP | 180 |
| Pullman, US | 178 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 166 |
| SLU Artdatabankenlocation not on record | 163 |
| Bloomington, US | 163 |
| TROMlocation not on record | 160 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 157 |
| Ann Arbor, US | 150 |
| Flagstaff, US | 148 |
| Corvallis, US | 144 |
| Davis, US | 143 |
| Kandalaksha State Nature Reservelocation not on record | 141 |
| Mount Annan, AU | 137 |
| Tallinn, EE | 134 |
| KMNlocation not on record | 132 |
| Montréal, CA | 128 |
| Vancouver, CA | 125 |
| 125 | |
| Riverside, US | 123 |
| Missoula, US | 120 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 119 |
| IFR-DNFlocation not on record | 119 |
| Chadron, US | 119 |
| Canberra, AU | 118 |
| Turku, FI | 117 |
| ASUlocation not on record | 111 |
| Oskarshamn, SE | 107 |
| GJOlocation not on record | 107 |
| Burlington, US | 104 |
| Entomological Society of Latvialocation not on record | 104 |
| Christchurch, NZ | 101 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 97 |
| Acadia Universitylocation not on record | 95 |
| Kunming, CN | 94 |
| Philadelphia, US | 94 |
| Museo Entomologico de Leonlocation not on record | 94 |
| Chiba, JP | 92 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 92 |
| Jyväskylä, FI | 91 |
| Adelaide, AU | 91 |
| Arcata, US | 90 |
| Odawara, JP | 88 |
| BDBClocation not on record | 88 |
| DOI/NPS, Greenbelt Parklocation not on record | 88 |
| South Kensington, GB | 86 |
| University of New Hampshirelocation not on record | 85 |
| Bozeman, US | 80 |
| University of Wisconsinlocation not on record | 79 |
| Wlocation not on record | 77 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 76 |
| Green Bay, US | 74 |
| UniKSlocation not on record | 74 |
| Kew, GB | 71 |
| Pocatello, US | 71 |
| MAlocation not on record | 70 |
| Spearfish, US | 70 |
| Angwin, US | 70 |
| Barcelona, ES | 69 |
| NSMKlocation not on record | 69 |
| Saint John, CA | 68 |
| Emporia, US | 66 |
| Provincia di Livornolocation not on record | 66 |
| Pretoria, ZA | 65 |
| Görlitz, DE | 64 |
| Tempe, US | 62 |
| Williamsburg, US | 62 |
| Auckland, NZ | 62 |
| Toyama, JP | 59 |
| Boise, US | 59 |
| College Park, US | 57 |
| Hobart, AU | 56 |
| Kuopio, FI | 56 |
| WINlocation not on record | 56 |
| València, ES | 56 |
| Bando, JP | 55 |
| New Haven, US | 54 |
| GMBAlocation not on record | 53 |
| Nanjing, CN | 52 |
| Wellington, NZ | 50 |
| Mlocation not on record | 47 |
| Santa Barbara, US | 46 |
| Uniwersytet Śląski w Katowicachlocation not on record | 46 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 45 |
| McWane Science Centerlocation not on record | 44 |
| Canadian Department of Agriculturelocation not on record | 44 |
| Rocky Mountain Biological Laboratorylocation not on record | 43 |
| BClocation not on record | 42 |
| Akita Prefectural Museumlocation not on record | 38 |
| Pittsburg, US | 38 |
| DMZ botanic gardenlocation not on record | 37 |
| Urumqi, CN | 37 |
| Phoenix, US | 36 |
| Uniwersytet Jagiellońskilocation not on record | 36 |
| Toronto, CA | 34 |
| Lincoln, US | 33 |
| Caldwell, US | 33 |
| CJBGlocation not on record | 33 |
| AASlocation not on record | 32 |
| Paris, FR | 31 |
| Mexico City, MX | 29 |
| Tsukuba, JP | 28 |
| Kyoto Universitylocation not on record | 27 |
| Provo, US | 27 |
| Madrid, ES | 27 |
| San Angelo, US | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 26 |
| EL PASO, US | 26 |
| Salamanca, ES | 26 |
| CICYTEXlocation not on record | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| Durango, MX | 25 |
| Bern, CH | 24 |
| Anchorage, US | 24 |
| Nijmegen, NL | 24 |
| Durango, US | 23 |
| Yangling, CN | 23 |
| Xining, CN | 22 |
| Pamplona, ES | 22 |
| Dresden, DE | 21 |
| Museo Achille Folettolocation not on record | 21 |
| Zürich, CH | 21 |
| San Diego, US | 21 |
| Tampa, US | 20 |
| Chicago, US | 20 |
| Copenhagen, DK | 20 |
| Kushiro City Museumlocation not on record | 20 |
| Torreón, MX | 19 |
| Bend, US | 19 |
| Otaru, JP | 18 |
| Xiamen, CN | 18 |
| Yukon Universitylocation not on record | 18 |
| Eastern Nevada Landscape Coalitionlocation not on record | 17 |
| Porrentruy, CH | 17 |
| Portland, US | 17 |
| Fukushima Universitylocation not on record | 17 |
| Dekalb, US | 17 |
| San Luis Obispo, US | 17 |
| Chengdu, CN | 17 |
| Pamplona, ES | 16 |
| Knoxville, US | 16 |
| USFS/BHSClocation not on record | 16 |
| nlocation not on record | 16 |
| Johnson City, US | 16 |
| Karlsruhe, DE | 16 |
| Montecillo, Texcoco, MX | 16 |
| Frankfurt am Main | 16 |
| Tromso University Museumlocation not on record | 16 |
| Grand Junction, US | 16 |
| Uniwersytet Opolskilocation not on record | 15 |
| Staten Island, US | 15 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 15 |
| Servico de Microbiologia e Imunologialocation not on record | 15 |
| Porvoo, FI | 15 |
| UGentlocation not on record | 15 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 14 |
| Davenport, US | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| Zürich, CH | 14 |
| Chapel Hill, US | 14 |
| US | 14 |
| Rovaniemi, FI | 14 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 13 |
| TUR-Alocation not on record | 13 |
| Armidale, AU | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Ashland, US | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Tuscaloosa, US | 13 |
| GZUlocation not on record | 12 |
| Mount Pleasant, US | 12 |
| Whitewater, US | 12 |
| Cheney, US | 12 |
| PRClocation not on record | 12 |
| Guangzhou, CN | 12 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 12 |
| UChlocation not on record | 12 |
| Fayetteville, US | 12 |
| Mississippi State, US | 12 |
| PrivatHerblocation not on record | 12 |
| Millersville, US | 11 |
| Science Museum of Minnesotalocation not on record | 11 |
| Cape Town, ZA | 11 |
| IWEP FEB RASlocation not on record | 11 |
| Tacoma, US | 10 |
| Rotorua, NZ | 10 |
| Los Angeles, US | 10 |
| Honolulu, US | 10 |
| Brisbane, AU | 10 |
| BISHlocation not on record | 10 |
| Museum of the Rockieslocation not on record | 9 |
| GB | 9 |
| Trois-Rivières, CA | 9 |
| Durham, US | 9 |
| University of Winnipeglocation not on record | 9 |
| Ciudad de México, MX | 9 |
| ENTClocation not on record | 9 |
| WNNUlocation not on record | 9 |
| Brookings, US | 9 |
| Jackson, US | 9 |
| USFSlocation not on record | 9 |
| CASlocation not on record | 8 |
| Bandelier National Monumentlocation not on record | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 8 |
| Lord Fairfax Community Collegelocation not on record | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| Chengdu, CN | 8 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 8 |
| Tula State Universitylocation not on record | 7 |
| Nishihara, JP | 7 |
| Weber State Universitylocation not on record | 7 |
| nbflocation not on record | 7 |
| VALElocation not on record | 7 |
| University of Lethbridgelocation not on record | 7 |
| KURAlocation not on record | 7 |
| Clemson, US | 7 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 7 |
| Austin, US | 7 |
| BSBIlocation not on record | 7 |
| Tokushima, JP | 7 |
| Fargo, US | 7 |
| Aarhus, DK | 7 |
| Osaka, JP | 7 |
| Irvine, US | 7 |
| Columbia, US | 7 |
| AUAlocation not on record | 7 |
| Truckee, US | 6 |
| STNFlocation not on record | 6 |
| Henderson, US | 6 |
| Badajoz, ES | 6 |
| Philadelphia, US | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| IDElocation not on record | 6 |
| Bourges, FR | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| SVN019location not on record | 6 |
| Forssa, FI | 6 |
| Chapingo, MX | 6 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Norfolk, US | 6 |
| Orem, US | 6 |
| JP | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Chicago, US | 6 |
| Fredericton Stock Culture Collectionlocation not on record | 6 |
| Jiangxi College of Educationlocation not on record | 5 |
| Yellowstone National Park Herbariumlocation not on record | 5 |
| OLAlocation not on record | 5 |
| Ypsilanti, US | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Mexico City, MX | 5 |
| Xian, CN | 5 |
| Beijing Normal Universitylocation not on record | 5 |
| Whitehorse, CA | 5 |
| Tilburg, NL | 5 |
| Springfield, US | 5 |
| Phyletisches Museum Jenalocation not on record | 5 |
| SWlocation not on record | 5 |
| Canadian Museum of Naturelocation not on record | 5 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 5 |
| US | 5 |
| Nishihara, JP | 5 |
| SZUlocation not on record | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| GAlocation not on record | 4 |
| Lanzhou, CN | 4 |
| NMBU:MINAlocation not on record | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| QVMAGlocation not on record | 4 |
| KOMlocation not on record | 4 |
| Sion, CH | 4 |
| Alicante, ES | 4 |
| QAUlocation not on record | 4 |
| Korea National Arboretumlocation not on record | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| KMCClocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Glarus, CH | 4 |
| China Agricultural Universitylocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Shanxi Institute of Biologylocation not on record | 4 |
| SEFlocation not on record | 4 |
| DULlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Tomioka, JP | 4 |
| Northridge, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| San Isidro, AR | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Oswego, US | 3 |
| Macomb, US | 3 |
| UIBlocation not on record | 3 |
| New Brunswick, US | 3 |
| University of Southern Mississippilocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Bangkok, TH | 3 |
| Podgorica, ME | 3 |
| Fairfax, US | 3 |
| Taipei, TW | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Montréal, CA | 3 |
| Palmerston, AU | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Hudson, US | 3 |
| BG-NMNHSlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| Kensington, AU | 3 |
| Guilin, CN | 3 |
| Jaén, ES | 3 |
| Portland, US | 3 |
| Lausanne, CH | 3 |
| Banyoles, ES | 3 |
| KNFHClocation not on record | 3 |
| Richmond, US | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Stockholm, SE | 3 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 3 |
| Sagamihara, JP | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Elocation not on record | 3 |
| Mexico City, MX | 2 |
| San Bernardino, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Research Collection of Siegrun Ertllocation not on record | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Minia, EG | 2 |
| Gijón, ES | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Kingston, US | 2 |
| UoB-IBlocation not on record | 2 |
| Taipei, TW | 2 |
| INFlocation not on record | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Dehra Dun, IN | 2 |
| Kirksville, US | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Culiacán, MX | 2 |
| Ivano-Frankove, UA | 2 |
| Waverly, US | 2 |
| Fort Worth, US | 2 |
| Durham, US | 2 |
| Dover, US | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| BGR001location not on record | 2 |
| Edinburgh, GB | 2 |
| Salvador, BR | 2 |
| Zhengzhou, CN | 2 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 2 |
| University of Helsinkilocation not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Metsähallituslocation not on record | 2 |
| Edmonton, CA | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Awka, NG | 1 |
| Sapporo, JP | 1 |
| BioFokuslocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| H-Diewaldlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| Loja, EC | 1 |
| Elikins, US | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Cape Town, ZA | 1 |
| UFSClocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Fort Bragg, US | 1 |
| Córdoba, AR | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| Boumlocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Zapopan, MX | 1 |
| Hamilton, US | 1 |
| FLADlocation not on record | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| MCNAMlocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Nanjing, CN | 1 |
| Decorah, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Fulda, DE | 1 |
| Winterthur, CH | 1 |
| Wollongong, AU | 1 |
| Dhaka, BD | 1 |
| Parkville, AU | 1 |
| Batemans Bay, AU | 1 |
| Kochi, JP | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Long Beach, US | 1 |
| Research Collection of Christian Lettnerlocation not on record | 1 |
| US | 1 |
| La Paz, BO | 1 |
| LUXEMBOURG, LU | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Granada, ES | 1 |
| KIWElocation not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Bothell, US | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| LINUlocation not on record | 1 |
| Seoul, KR | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Austin, US | 1 |
| Guangzhou, CN | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Valparaíso, CL | 1 |
| The University of Arizonalocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| GINRlocation not on record | 1 |
| University of Central Missourilocation not on record | 1 |
| Portland, US | 1 |
| Keene State Universitylocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Namur, BE | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Buenos Aires, AR | 1 |
| Monastir, TN | 1 |
| Tapachula, MX | 1 |
| Brussel, BE | 1 |
| Conway, US | 1 |
| Turlock, US | 1 |
| DNSMlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Coimbra, PT | 1 |
| Ivano-Frankivsk, UA | 1 |
| H-Schuhwlocation not on record | 1 |
| Little Rock, US | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| TAIElocation not on record | 1 |
499 institutions · 55 902 of 57 683 vouchered records shown · 1 541 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA107 detections
Where the DNA of Poa pratensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found107
Studies independent surveys1
Countries17
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 107 detections have coordinates
Open the map17 countries0
With Alium, Carex, other grassesRiparian Meadow-ShrubSlightly undulating, sloping area with dry u…Burned in 2007. Huge seep that is on a slope…Wet forest, subalpine fir/Globe huckleberry-…Xeric Salix uva-ursi â Festuca brachiphyll…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 3.80–18.2
Seasonal swing summer↔winter23.7 °C
Max temp (day)16.2 °C 4.00–23.6
Min temp (night)8.00 °C 0.3–13.5
Precipitation75.7 mm/mo 25.1–131
Air humidity60.4 % 50.3–66.4
Moisture balance-20.0 mm/mo -98.4–53.1
Vapour deficit586 Pa 351–900
Wind speed3.50 m/s 2.10–5.70
Cloud cover41.2 % 24.6–64.0
CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.