Pnoepyga formosana

Ingram, 1909 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Pnoepygidae/Pnoepyga

At a glance

Occurrence records18 264

Data sources8

Biological traits24

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Pnoepyga formosana's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 264 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF18 264 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The Taiwan cupwing or Taiwan wren-babbler (Pnoepyga formosana) is a species of passerine bird in the family Pnoepygidae. The species is endemic to the island of Taiwan. It was treated for a long time as a subspecies of the scaly-breasted cupwing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth3.1 mm

Beak length (culmen)12.9 mm

Beak length (nares)7.2 mm

Beak width2.4 mm

Body mass20 g

Body mass (female)20 g

Body mass (male)20.7 g

Hand-wing index13.9

Kipp's distance7.4 mm

Secondary length45.9 mm

Tail length15 mm

Tarsus length21 mm

Wing length53.2 mm

Life cycle & reproduction1

Egg mass1.93 g

Diet & foraging6

Ground60 %

Invertebrate50 %

Seed50 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory40 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleGeneralist

Range size17 049 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pnoepyga formosana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P686 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BINs0

ATGTAGACTTCTGGGTGGCCGAAGAATCAGAATAGGTGTTGGTATAGTACTGGGTCTCCTCCGCCTGCGGGGTCGAAGAAGGTGGTGTTG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pnoepyga pusillasame genus9.1%Pycnonotus goiaviersame order10.2%Sylvia currucasame order10.7%Phoenicurus erythrogastrussame order10.7%Vireo nanussame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 264 records

Wild obs. + sensor18 261

Museum / vouchered3

Range

Area of Occupancy AOO2 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 567≤1 km 605≤10 km 852>10 km 3

3 027 georeferenced · 15 234 without coordinates

Open the mapobservation + sensor18 261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Dong Hwa University, College of Environmental Studieslocation not on record	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pnoepyga formosana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 6.70–14.3

Seasonal swing summer↔winter10.9 °C

Max temp (day)14.0 °C 9.60–17.4

Min temp (night)6.60 °C 2.70–9.80

Precipitation196 mm/mo 111–387

Air humidity64.7 % 64.2–64.8

Moisture balance99.7 mm/mo 53.7–273

Vapour deficit454 Pa 355–581

Wind speed2.50 m/s 2.50–2.80

Cloud cover42.2 % 37.8–52.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pnoepyga formosana

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction1

Diet & foraging6

Habitat & environment4

At a glance

Record type18 264 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type18 264 records