Pnirontis modesta

Banks, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Reduviidae/Pnirontis

At a glance

Occurrence records128

Data sources6

Biological traits0

DNA specimens7

eDNA detections2

Sources6 archives

Databases and archives Pnirontis modesta's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Pnirontis modesta is a species of assassin bug in the family Reduviidae. It is found in the Caribbean and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pnirontis modesta has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

166Amostly conserved

202Amostly conserved

346Cmostly conserved

401Cmostly conserved

AACCCTGTATTTTATACTAGGTGCCTGAGCTGGAATAGTTGGAACATCCCTTAGATGACTGATTCGAATTGAACTAGGACAACCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lygus rugulipennissame order16.9%Lygus striatussame order17.0%Lygus keltonisame order17.2%Lygus hesperussame order17.2%Lygus atriflavussame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type128 records

Wild obs. + sensor29

Museum / vouchered99

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 8≤1 km 15≤10 km 1

24 georeferenced · 5 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 3≤10 km 15

18 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	47
Champaign, US	20
CUlocation not on record	16
University of Central Floridalocation not on record	7
College Station, US	4
North Carolina State University Insect Museumlocation not on record	3
Montgomery, US	1
University of Guelphlocation not on record	1

8 institutions · 99 of 99 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Pnirontis modesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)