Ploceus melanogaster

Shelley, 1887 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records3 864

Data sources8

Biological traits26

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Ploceus melanogaster's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 864 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF3 864 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The black-billed weaver (Ploceus melanogaster) is a species of bird in the family Ploceidae. It has a discontinuous distribution from extreme eastern West Africa through parts of Central Africa to East Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth6.1 mm

Beak length (culmen)19 mm

Beak length (nares)12.6 mm

Beak width5.4 mm

Body mass22.5 g

Body mass (female)22.6 g

Body mass (male)23.2 g

Hand-wing index10.9

Kipp's distance7.6 mm

Secondary length61.7 mm

Tail length48 mm

Tarsus length20.3 mm

Wing length69.2 mm

Life cycle & reproduction2

Egg mass2.74 g

Litter size2

Diet & foraging7

Fruit10 %

Ground50 %

Invertebrate80 %

Seed10 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory50 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size221 733 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus melanogaster has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

eDNA detections5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P298 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

22Gmostly conserved

43Cmostly conserved

274Tvariable

TCTCTACCTAATCTTCGGTGCGTGAGCCGGAATGGTGGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes3

BINs0

Most divergent pair1.0%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 864 records

Wild obs. + sensor3 833

Museum / vouchered14

Other17

Range

Area of Occupancy AOO1 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 32≤1 km 24≤10 km 3

59 georeferenced · 3 774 without coordinates

Open the mapobservation + sensor3 833

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	9
Stockholm, SE	4

2 institutions · 13 of 14 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Ploceus melanogaster was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ploceus melanogaster

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging7

Habitat & environment4

At a glance

Record type3 864 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 864 records