Ploceus melanocephalus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records41 050

Data sources9

Biological traits25

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Ploceus melanocephalus's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 050 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF41 050 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

The black-headed weaver (Ploceus melanocephalus), also known as yellow-backed weaver, is a species of bird in the family Ploceidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth7.3 mm

Beak length (culmen)16.2 mm

Beak length (nares)10.9 mm

Beak width5.8 mm

Body mass23.5 g

Body mass (female)21.4 g

Body mass (male)27.15 g

Hand-wing index18.3

Kipp's distance13.1 mm

Secondary length58.9 mm

Tail length46.8 mm

Tarsus length20.5 mm

Wing length72 mm

Life cycle & reproduction2

Egg mass2.1 g

Litter size2.45

Diet & foraging6

Invertebrate50 %

Midhigh50 %

Seed50 %

Trophic levelomnivore

Trophic nicheGranivore

Understory50 %

Habitat & environment4

HabitatWetland

Migration1.0

Primary lifestyleInsessorial

Range size1 181 602 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus melanocephalus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

eDNA detections7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P298 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BINs0

Most divergent pair0.67%

Where individuals differ — all 2 variable positions, in barcode order

118Avariable

247Tvariable

CCTATACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 050 records

Wild obs. + sensor40 988

Museum / vouchered32

Other30

Origin

Native8 622

Range

Area of Occupancy AOO13 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 2 074≤1 km 386≤10 km 176>10 km 45

2 681 georeferenced · 38 307 without coordinates

Open the mapobservation + sensor40 988

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8

8 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	19
Seattle, US	3
Geneva, CH	2
Copenhagen, DK	2
Brussels, BE	2
Paris, FR	1
Ann Arbor, US	1
RBINS-Scientific Heritagelocation not on record	1

8 institutions · 31 of 32 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Ploceus melanocephalus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ploceus melanocephalus

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging6

Habitat & environment4

At a glance

Record type41 050 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type41 050 records