Ploceus insignis

(Sharpe, 1891) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records6 389

Data sources9

Biological traits25

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Ploceus insignis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF6 389 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

The brown-capped weaver (Ploceus insignis) is a species of bird in the family Ploceidae. It is found in Angola, Burundi, Cameroon, Republic of the Congo, Democratic Republic of the Congo, Equatorial Guinea, Kenya, Nigeria, Rwanda, South Sudan, Tanzania, and Uganda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth5.8 mm

Beak length (culmen)18 mm

Beak length (nares)9.8 mm

Beak width4.6 mm

Body mass27.5 g

Body mass (female)26.5 g

Body mass (male)27.75 g

Hand-wing index19.3

Kipp's distance16 mm

Secondary length66.9 mm

Tail length48.4 mm

Tarsus length19.9 mm

Wing length83.5 mm

Life cycle & reproduction2

Egg mass2.78 g

Litter size2

Diet & foraging6

Fruit40 %

Ground80 %

Invertebrate60 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory20 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size247 177 km²

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus insignis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

eDNA detections6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P298 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BINs0

CCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 389 records

Wild obs. + sensor6 346

Museum / vouchered13

Other30

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 153≤1 km 32≤10 km 12>10 km 5

202 georeferenced · 6 144 without coordinates

Open the mapobservation + sensor6 346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 3>10 km 1

5 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MRAClocation not on record	4
Berkeley, US	3
Copenhagen, DK	3
New Haven, US	1
Brussels, BE	1

5 institutions · 12 of 13 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Ploceus insignis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ploceus insignis

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging6

Habitat & environment4

At a glance

Record type6 389 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type6 389 records