Ploceus grandis

(G.R.Gray, 1844) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records565

Data sources8

Biological traits22

DNA specimens4

eDNA detections1

Sources8 archives

Databases and archives Ploceus grandis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF565 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

The giant weaver (Ploceus grandis) is a species of bird in the family Ploceidae. It is endemic to São Tomé Island. It can climb trees and branches, rather like a treecreeper or sittella. Its natural habitat is subtropical or tropical moist lowland forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAVONETAmnioteDB

Size & morphology11

Beak depth11.3 mm

Beak length (culmen)28.3 mm

Beak length (nares)19.9 mm

Beak width8.9 mm

Body mass63.5 g

Hand-wing index19.6

Kipp's distance20.9 mm

Secondary length85.9 mm

Tail length70.2 mm

Tarsus length29.3 mm

Wing length107 mm

Life cycle & reproduction1

Litter size1.5

Diet & foraging6

Fruit10 %

Ground100 %

Invertebrate50 %

Seed40 %

Trophic levelherbivore

Trophic nicheGranivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size859 km²

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus grandis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

100Amostly conserved

TACCCTATACCTAATTTTCGGTGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCCGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ploceus princepssame genus2.3%Ploceus nigerrimussame genus7.1%Ploceus sanctithomaesame genus7.6%Ploceus velatussame genus8.1%Ploceus galbulasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type565 records

Wild obs. + sensor517

Museum / vouchered48

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 10≤1 km 9>10 km 17

36 georeferenced · 481 without coordinates

Open the mapobservation + sensor517

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	20
Instituto de Investigação Científica Tropicallocation not on record	19
Ann Arbor, US	3
Cambridge, US	1
South Kensington, GB	1
Toronto, CA	1

6 institutions · 45 of 48 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Ploceus grandis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)