Ploceus baglafecht

(Daudin, 1802) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records54 553

Data sources9

Biological traits27

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Ploceus baglafecht's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF54 553 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The baglafecht weaver (Ploceus baglafecht) is a species of weaver bird from the family Ploceidae which is found in eastern and central Africa. There are several disjunct populations with distinguishable plumage patterns. Only some races display a discrete non-breeding plumage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth8.1 mm

Beak length (culmen)19.5 mm

Beak length (nares)12.4 mm

Beak width6.7 mm

Body mass31.32 g

Body mass (female)30.7 g

Body mass (male)32.4 g

Hand-wing index16.5

Kipp's distance13 mm

Secondary length66 mm

Tail length57.3 mm

Tarsus length23.3 mm

Wing length79 mm

Life cycle & reproduction2

Egg mass2.74 g

Litter size2.2

Diet & foraging8

Fruit10 %

Ground40 %

Invertebrate70 %

Nectar10 %

Seed10 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory60 %

Habitat & environment4

HabitatShrubland

Migration1.0

Primary lifestyleInsessorial

Range size1 651 063 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus baglafecht has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

eDNA detections5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P298 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)3.3%

Haplotypes1

BINs0

Where individuals differ — all 17 variable positions, in barcode order

8Tvariable

34Gmostly conserved

46Tvariable

61Tvariable

127Gvariable

139Cvariable

142Gmostly conserved

160Tvariable

178Avariable

181Avariable

208Gvariable

220Avariable

244Tvariable

271Cvariable

280Cmostly conserved

281Cvariable

295Tvariable

CCTATACTTAATCTTTGGCGCATGAGCCGGGATGGTAGGAACCGCTCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type54 553 records

Wild obs. + sensor54 434

Museum / vouchered56

Other63

Origin

Native9

Range

Area of Occupancy AOO21 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 1 279≤1 km 483≤10 km 193>10 km 346

2 301 georeferenced · 52 133 without coordinates

Open the mapobservation + sensor54 434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 21>10 km 5

26 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Seattle, US	24
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	19
Ann Arbor, US	8
Salzburg, AT	3
Geneva, CH	2

5 institutions · 56 of 56 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Ploceus baglafecht was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ploceus baglafecht

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging8

Habitat & environment4

At a glance

Record type54 553 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type54 553 records