Ploceus aurantius

(Vieillot, 1805) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Ploceidae/Ploceus

At a glance

Occurrence records2 924

Data sources8

Biological traits24

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Ploceus aurantius's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 924 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF2 924 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

The orange weaver (Ploceus aurantius) is a species of bird in the weaver family, Ploceidae. It is sparsely distributed across African tropical rainforest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth6.1 mm

Beak length (culmen)17.3 mm

Beak length (nares)10.5 mm

Beak width5 mm

Body mass23 g

Body mass (female)25 g

Body mass (male)23.7 g

Hand-wing index19.4

Kipp's distance13.3 mm

Secondary length55.6 mm

Tail length44.4 mm

Tarsus length18.9 mm

Wing length69.6 mm

Life cycle & reproduction2

Egg mass2.22 g

Litter size2

Diet & foraging5

Ground100 %

Invertebrate30 %

Seed70 %

Trophic levelomnivore

Trophic nicheOmnivore

Habitat & environment4

HabitatWetland

Migration1.0

Primary lifestyleInsessorial

Range size441 030 km²

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ploceus aurantius has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes1

eDNA detections10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P297 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

4Avariable

13Tvariable

31Avariable

73Amostly conserved

82Tvariable

89Cmostly conserved

94Amostly conserved

112Cmostly conserved

124Cmostly conserved

139Cvariable

169Tvariable

175Cvariable

178Gmostly conserved

181Cvariable

196Avariable

199Cvariable

202Cmostly conserved

214Amostly conserved

220Avariable

226Avariable

229Amostly conserved

247Cvariable

250Avariable

259Avariable

262Tmostly conserved

265Cvariable

280Cmostly conserved

283Amostly conserved

CCTATACCTAATTTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes6

BINs0

Most divergent pair6.7%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 924 records

Wild obs. + sensor2 890

Museum / vouchered33

Other1

Origin

Native2

Range

Area of Occupancy AOO2 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 255≤1 km 59≤10 km 12>10 km 2

328 georeferenced · 2 562 without coordinates

Open the mapobservation + sensor2 890

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2>10 km 2

4 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	20
Seattle, US	3
Berkeley, US	3
	2
Philadelphia, US	1
MRAClocation not on record	1
Bourges, FR	1
Washington, US	1
GBClocation not on record	1

9 institutions · 33 of 33 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Ploceus aurantius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ploceus aurantius

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging5

Habitat & environment4

At a glance

Record type2 924 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 924 records