Plocama pendula

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Plocama

At a glance

Occurrence records980

Data sources14

Biological traits25

DNA specimens3

eDNA detections2

Sources14 archives

Databases and archives Plocama pendula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility980 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF980 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Plocama pendula is a species of flowering plant in the coffee family Rubiaceae, endemic to the Canary islands. It is a shrub growing up to 2 m, with filiform (very narrow leaves) and minute flowers grouped near the tips of slender, pendulous branches. The fruit is a black berry. Flowers and young fruit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf length max50 mm

Leaf length min50 mm

Plant height1.5 m

Plant height max4 m

Plant height min1 m

Seed volume0.62 mm³

Seed volume max0.62 mm³

Seed volume min0.62 mm³

Life cycle & reproduction7

Deciduousnessevergreen

Flower colourwhite

Flowering endJul

Flowering startMar

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Fruit fleshinessfleshy

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Leaf formfiliform

Woodinesswoody

Other traits1

Leaf arrangementopposite

03Chemical composition34 compounds

Compounds documented for Plocama pendula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones22

Labdane diterpenoids2

Naphthalenes and derivatives $ Naphthoquinones1

Flavonols1

Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids1

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,3aR,4S,5R,7aR,7bS)-4-[(3R)-3-hydroxy-3-methylpent-4-enyl]-3a,5,7b-trimethyl-1,1a,2,3,4,6,7,7a-octahydrocyclopropa[a]naphthalen-5-ol	present	NPASS
(1R,4R,5R,9S,10S,13R,15S)-15-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,4R,5R,9S,10S,13R,15S)-15-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,2R,4aR,8aR)-1-[(3R)-3-hydroxy-3-methylpent-4-enyl]-2,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-2-ol	present	NPASS
(1S,4R,9R,10S,13R)-5,5,9-trimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane	present	NPASS
(2R)-5,9-dihydroxy-2-methyl-3,4-dihydro-2H-anthracen-1-one	present	LOTUS
(2R)-6,9-dihydroxy-5-methoxy-2-methyl-3,4-dihydro-2H-anthracen-1-one	present	LOTUS
(4aR,9aS,10R)-10-hydroxy-2-methyl-4,4a,9a,10-tetrahydro-1H-anthracen-9-one	present	LOTUS
1,3-Dimethoxy-2-hydroxy-9,10-anthraquinone	present	LOTUS
1,5-Dihydroxy-2-methylanthracene-9,10-dione	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plocama pendula has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOU026708.1 ↗557 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGACGACCGCGAACGAGTACGCAAACCGCGGGGAGCGGGGAGGCGGGGGCG …

Plocama pendula genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, isolate IS621, specimen voucher M. Mairal MM226 (1)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL1★ITS8

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Plocama pendula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 415 655 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Plocama pendula1.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidy4× tetraploid · measured

Chromosome records44–442n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 445×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Larsen 1958b, 1960b

CCDB · kew — Kiehn M. 1986. Karyosystematische Untersuchungen und DNA-Messungen an Rubiaceae und ihre Bedeutung für die Systematik dieser Familie. Ph. D. Thesis. Universität Wien.

CCDB · Cave1958 — Larsen 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type980 records

Wild obs. + sensor907

Museum / vouchered73

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 371≤1 km 113≤10 km 231>10 km 16

731 georeferenced · 176 without coordinates

Open the mapobservation + sensor907

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 2≤1 km 7≤10 km 4>10 km 1

14 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	6
València, ES	5
GJOlocation not on record	3
LDlocation not on record	3
College of the Atlantic, Museumlocation not on record	3
Saint Louis, US	3
MeiseBGlocation not on record	3
Madrid, ES	2
Salamanca, ES	2
Moscow State Universitylocation not on record	2
BClocation not on record	2
Museo Achille Folettolocation not on record	2
Uppsala, SE	2
Görlitz, DE	1
BRNUlocation not on record	1
Kew, GB	1
John May Museum of Natural Historylocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
WAGlocation not on record	1
Berlin, DE	1
Edinburgh, GB	1
South Kensington, GB	1
Barcelona, ES	1
Coimbra, PT	1
Vitoria, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1
Universität Göttingenlocation not on record	1
Madrid, ES	1
Wlocation not on record	1

29 institutions · 54 of 73 vouchered records shown · 19 without an institution code

09Environmental DNA2 detections

Where the DNA of Plocama pendula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)