Plicosepalus acaciae

(Zucc.) Wiens & Polhill · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Plicosepalus

At a glance

Occurrence records842

Data sources7

Biological traits13

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Plicosepalus acaciae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility842 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~14.87 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF842 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT14.9 Gbp

01Narrative

Plicosepalus acaciae (syn. Loranthus acaciae), the acacia strap flower, is a species of hemiparasitic flowering plant in the family Loranthaceae. It is native to northeastern Africa, the Levant, and the Arabian Peninsula. As its common and scientific names suggest, it parasitizes acacias; Vachellia tortilis subsp. raddiana (formerly Acacia raddiana) and V. t. subsp. tortilis (formerly A. tortilis). It seeds are dispersed by the white-spectacled bulbul (Pycnonotus xanthopygos).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height0.4 m

Life cycle & reproduction5

Flowering endOct

Flowering startSep

Life formhemiparasitic epiphyte

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plicosepalus acaciae has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR327075.1 ↗284 bpSaudi Arabia · 2021

ACGT

TCGAAACCTGCACAGCAGAGCGAACCCGCGGACCCGTTCAATCGATCGGCGGGGGGAGGGCCTGCCGCTCGCCCCCCGTCACGCCTCGCG …

Plicosepalus acaciae voucher A10031 (UQU) internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Plicosepalus acaciae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size14 865 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Plicosepalus acaciae14.87 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type842 records

Wild obs. + sensor781

Museum / vouchered61

Range

Area of Occupancy AOO1 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 33≤1 km 14≤10 km 44>10 km 1

92 georeferenced · 689 without coordinates

Open the mapobservation + sensor781

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 61 records without

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	17
Berlin, DE	11
MeiseBGlocation not on record	5
Moscow State Universitylocation not on record	4
Edinburgh, GB	4
Uppsala, SE	3
Saint Louis, US	2
Wlocation not on record	2
Stockholm, SE	1
Frankfurt am Main	1
University of Stellenboschlocation not on record	1

11 institutions · 51 of 61 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)