Plicofollis argyropleuron

(Valenciennes, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Ariidae/Plicofollis

At a glance

Occurrence records212

Data sources9

Biological traits5

DNA specimens26

eDNA detections15

Sources9 archives

Databases and archives Plicofollis argyropleuron's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

OBISOcean Biodiversity Information System125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS212 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD26 specimens

01Narrative

The longsnouted catfish (Plicofollis argyropleuron), also known as the Broadbent's catfish, the spoon-nosed catfish, the large-scaled catfish, the sharp-headed catfish, or the sand catfish,Common names of Plicofollis argyropleuron at www.fishbase.org. is a species of catfish in the family Ariidae. It was described by Achille Valenciennes in 1840, originally under the genus Arius. It inhabits brackish and marine waters in New Guinea, Australia, and southern and southeastern Asia. It reaches a maximum total length of 50 cm. The diet of the longsnouted catfish includes bony fish, benthic crustaceans including crabs and prawns, detritus, mollusks, polychaete and annelid worms, algae and mud.Food and Feeding Habits Summary for Plicofollis argyropleuron (A) at www.fishbase.org.Food and Feeding Habits Summary for Plicofollis argyropleuron (B) at www.fishbase.org.Food items reported for Plicofollis argyropleuron at www.fishbase.org.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length50 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability40

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plicofollis argyropleuron has left across the world's sequence archives.

At a glance

DNA specimens26

BINs3

Marker genes2

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

54Tmostly conserved

69Cmostly conserved

78Tmostly conserved

81Cmostly conserved

84Tmostly conserved

93Cmostly conserved

102Tmostly conserved

108Cvariable

111Gmostly conserved

129Amostly conserved

159Cmostly conserved

180Cmostly conserved

186Cmostly conserved

189Tmostly conserved

192Cvariable

216Cmostly conserved

219Amostly conserved

228Amostly conserved

231Cvariable

234Cmostly conserved

237Tmostly conserved

243Tmostly conserved

247Cvariable

255Tmostly conserved

282Gmostly conserved

285Amostly conserved

303Amostly conserved

321Amostly conserved

324Cmostly conserved

333Tmostly conserved

342Cmostly conserved

345Cvariable

363Tmostly conserved

366Tmostly conserved

369Tvariable

378Avariable

381Avariable

384Amostly conserved

396Amostly conserved

402Tmostly conserved

420Tvariable

429Cmostly conserved

432Gvariable

438Cvariable

441Avariable

444Amostly conserved

450Avariable

495Cvariable

498Avariable

501Cmostly conserved

507Cmostly conserved

510Tmostly conserved

513Tmostly conserved

516Cvariable

525Gmostly conserved

531Cvariable

534Cmostly conserved

537Cvariable

543Gvariable

547Tvariable

561Cmostly conserved

564Cmostly conserved

567Cvariable

570Tmostly conserved

585Cvariable

594Amostly conserved

612Tmostly conserved

618Tvariable

ATAGTTGGAACCGCCCTTAGCCTGCTAATTCGGGCAGAATTAGCCCAACCCGGTGCCCTTCTAGGCGACGATCAAATTTACAATGTTATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes3

BINs3

Most divergent pair9.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plicofollis layardisame genus2.6%Plicofollis polystaphylodonsame genus4.3%Plicofollis nellasame genus4.7%Netuma thalassinasame family6.0%Plicofollis magatensissame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

07Deep time~2.93 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.93 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type212 records

Wild obs. + sensor72

Museum / vouchered140

Range

Area of Occupancy AOO280 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17.5 m · max 26 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 24

28 georeferenced · 44 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 6≤1 km 23≤10 km 14>10 km 2

45 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	22
Australian National Fish Collectionlocation not on record	8
Sydney, AU	7
Fisheries Research Laboratory, Mie Universitylocation not on record	2
FishBaselocation not on record	2
DEWlocation not on record	2
Montgomery, US	1
Mutare Museumlocation not on record	1
	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

10 institutions · 47 of 140 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Plicofollis argyropleuron was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

Estuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 26.2–27.0

Seasonal swing summer↔winter0.9 °C

Max temp (day)30.8 °C 28.8–30.8

Min temp (night)22.2 °C 22.2–24.6

Precipitation364 mm/mo 135–364

Air humidity69.5 % 63.0–69.5

Moisture balance208 mm/mo -23.6–208

Vapour deficit1,035 Pa 1,035–1,313

Wind speed0.7 m/s 0.7–2.90

Cloud cover27.0 % 27.0–27.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)