Pleurotus populinus

O.Hilber & O.K.Mill. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Pleurotaceae/Pleurotus

At a glance

Occurrence records1 341

Data sources8

Biological traits0

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Pleurotus populinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 341 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 341 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Pleurotus populinus, the aspen oyster mushroom, is a gilled fungus native to North America. It is found on dead wood of aspen and cottonwood trees (genus Populus). Although morphologically similar to Pleurotus ostreatus and Pleurotus pulmonarius, it has been shown to be a distinct species incapable of cross-breeding. P. populinus is reported to be edible. Unlike P. ostreatus, which fruits in the autumn and winter, P. populinus fruits in late spring and summer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pleurotus populinus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR644386.1 ↗568 bp

ACGT

ATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGATCTG …

Pleurotus populinus strain KACC51359 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type1 341 records

Wild obs. + sensor1 290

Museum / vouchered51

Range

Area of Occupancy AOO4 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 633≤1 km 147≤10 km 112>10 km 148

1 040 georeferenced · 250 without coordinates

Open the mapobservation + sensor1 290

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 7≤1 km 7≤10 km 8>10 km 1

23 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	13
Université de Montréal Biodiversity Centrelocation not on record	9
TENN-Flocation not on record	7
University of Tennessee at Chattanoogalocation not on record	3
Chicago, US	3
St. Paul, US	3
Logan, US	2
WTUlocation not on record	1
Durham, US	1
Vancouver, CA	1
Ann Arbor, US	1
Bronx, US	1
Personal Herbarium of Zebediah Raneylocation not on record	1
Toronto, CA	1
Blacksburg, US	1

15 institutions · 48 of 51 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Pleurotus populinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

riverbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.5–12.8

Seasonal swing summer↔winter25.6 °C

Max temp (day)19.5 °C 18.6–20.4

Min temp (night)6.90 °C 5.80–8.00

Precipitation69.6 mm/mo 61.5–77.6

Air humidity55.9 % 54.8–57.1

Moisture balance-60.1 mm/mo -77.5–-42.7

Vapour deficit704 Pa 681–727

Wind speed4.30 m/s 3.10–5.50

Cloud cover37.4 % 36.8–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pleurotus populinus

At a glance

Sources8 archives

At a glance

Record type1 341 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 341 records