Pleurotus albidus

(Berk.) Pegler · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Pleurotaceae/Pleurotus

At a glance

Occurrence records88

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Pleurotus albidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

محاري مبيض هو نوع من الفطريات يتبع جنس المحاري من فصيلة المحارية.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pleurotus albidus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKF280339.1 ↗466 bpBrazil

ACGT

AGTCTTTCAACCACCTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTCAGACTTGGTTGCTGGGACTTAAACGTCTCGGT …

Pleurotus albidus voucher SP445809 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor66

Museum / vouchered22

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 15≤1 km 24≤10 km 6>10 km 4

49 georeferenced · 17 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	6
IPA/SPlocation not on record	5
Durango, MX	3
Schenectady, US	2
Bronx, US	1
Lincoln, US	1

6 institutions · 18 of 22 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Pleurotus albidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 15.9–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)24.6 °C 21.8–30.2

Min temp (night)17.4 °C 11.5–21.3

Precipitation164 mm/mo 66.4–217

Air humidity64.0 % 54.7–68.3

Moisture balance32.9 mm/mo -49.9–88.2

Vapour deficit875 Pa 769–1,154

Wind speed1.70 m/s 1.10–3.80

Cloud cover31.5 % 27.2–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)