Plesanemma fucata

Felder & Rogenhofer, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Plesanemma

At a glance

Occurrence records910

Data sources7

Biological traits0

DNA specimens59

eDNA detections58

Sources7 archives

Databases and archives Plesanemma fucata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility910 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF910 records

Environmental DNA1 datasets · 1 countries58 detections

DNA & barcodingBOLD59 specimens

01Narrative

Plesanemma fucata, the lemon gum moth, is a moth of the family Geometridae. The species was first described by Rudolf Felder and Alois Friedrich Rogenhofer in 1875. It is found in the southern half of Australia. The wingspan is about 40 mm. The larvae feed on Eucalyptus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plesanemma fucata has left across the world's sequence archives.

At a glance

DNA specimens59

BINs3

Marker genes1

eDNA detections58

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

16Tvariable

28Amostly conserved

74Tmostly conserved

82Cmostly conserved

88Tmostly conserved

91Tmostly conserved

100Tmostly conserved

106Tvariable

124Cmostly conserved

133Amostly conserved

145Tmostly conserved

172Tmostly conserved

199Amostly conserved

220Amostly conserved

223Amostly conserved

232Tvariable

238Tmostly conserved

262Amostly conserved

283Tmostly conserved

287Tmostly conserved

304Tvariable

313Tmostly conserved

316Amostly conserved

343Amostly conserved

352Tmostly conserved

361Tmostly conserved

367Tmostly conserved

382Amostly conserved

388Avariable

394Tmostly conserved

403Tmostly conserved

412Avariable

433Amostly conserved

442Tmostly conserved

448Tmostly conserved

517Tvariable

520Avariable

539Cmostly conserved

541Cvariable

542Tmostly conserved

547Amostly conserved

548Cmostly conserved

562Gvariable

571Tmostly conserved

574Tmostly conserved

577Gvariable

616Tvariable

619Tmostly conserved

622Amostly conserved

625Gvariable

628Amostly conserved

637Tmostly conserved

640Tmostly conserved

646Cmostly conserved

AACACTTTATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes21

BINs3

Most divergent pair7.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mictodoca toxeutasame family6.4%Callioratis mayerisame family6.4%Callioratis abraxassame family6.8%Thalaina macfarlandisame family6.8%Middletonia hemichromasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type910 records

Wild obs. + sensor667

Museum / vouchered187

Other56

Origin

Native2

Range

Area of Occupancy AOO1 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 262≤1 km 177≤10 km 32>10 km 42

513 georeferenced · 154 without coordinates

Open the mapobservation + sensor667

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 48≤10 km 9

57 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	113
Tasmanian Museum & Art Gallerylocation not on record	39
QVMAGlocation not on record	17
Tallinn, EE	4
ZSMlocation not on record	3
DPIlocation not on record	2
Australian National Insect Collectionlocation not on record	1

7 institutions · 179 of 187 vouchered records shown · 8 without an institution code

09Environmental DNA58 detections

Where the DNA of Plesanemma fucata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.0–16.5

Seasonal swing summer↔winter8.50 °C

Max temp (day)18.2 °C 15.6–21.9

Min temp (night)8.50 °C 8.40–13.1

Precipitation50.5 mm/mo 41.2–105

Air humidity59.0 % 55.3–59.1

Moisture balance-18.7 mm/mo -60.7–35.2

Vapour deficit621 Pa 574–843

Wind speed3.60 m/s 2.00–3.90

Cloud cover20.8 % 16.6–37.8

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)