Platanthera leucophaea

(Nutt.) Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Platanthera

At a glance

Occurrence records512

Data sources12

Biological traits14

DNA specimens5

eDNA detections2

Sources12 archives

Databases and archives Platanthera leucophaea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF512 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Platanthera leucophaea, commonly known as the prairie white fringed orchid or eastern prairie fringed orchid, is a rare species of orchid native to North America. It is listed as a threatened species in the United States on September 28, 1989. The IUCN does not currently recognize it as being at risk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height1.5 m

Seed mass0.004 mg

Seed mass max0.004 mg

Seed mass min0.004 mg

Life cycle & reproduction3

Life formperennial or tuberous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Platanthera leucophaea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG216132.1 ↗365 bpCanada · 1934

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCTGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATT …

Platanthera leucophaea voucher CCDB-18296-G12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Platanthera leucophaea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type512 records

Wild obs. + sensor415

Museum / vouchered97

Range

Area of Occupancy AOO1 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤100 m 2≤10 km 1>10 km 409

412 georeferenced · 3 without coordinates

Open the mapobservation + sensor415

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 7≤10 km 24>10 km 3

35 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	46
Bronx, US	27
Saint Louis, US	6
International Salmonella Centre (W.H.O.)location not on record	5
Chicago, US	4
Université Lavallocation not on record	2
Wuzhou, CN	1
Acadia Universitylocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Royal Ontario Museumlocation not on record	1

10 institutions · 94 of 97 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Platanthera leucophaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

stony shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 18.1–18.1

Seasonal swing summer↔winter29.8 °C

Max temp (day)23.5 °C

Min temp (night)13.2 °C

Precipitation84.1 mm/mo

Air humidity57.6 %

Moisture balance-53.1 mm/mo

Vapour deficit882 Pa

Wind speed2.40 m/s

Cloud cover43.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)