Plantago media
speciesAt a glance
Occurrence records324 639
Data sources13
Biological traits49
DNA specimens37
eDNA detections21
Sources13 archives
Databases and archives Plantago media's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility324 638 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Chemical compositionLOTUS13 compounds
Occurrence & distributionGBIF · PBDB324 639 records
Environmental DNA1 datasets · 4 countries21 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT · NCBI2.6 Gbp
Deep timePBDB1 fossils
01Narrative
Plantago media, le plantain moyen, plantain intermédiaire, plantain bâtard, plantain blanc ou langue d'agneau, est une plante herbacée vivace de la famille des Plantaginacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Leaf mass245 mg
Leaf size1 913 mm²
⚠ sources differ — TRY: 1 913 mm² · LEDA: 4 553 mm² · GIFT: 4 828 mm²
Plant height0.172 m
⚠ sources differ — GIFT: 0.172 m · LEDA: 0.05 m · TRY: 0.12 m
Plant height generative0.247 m
Plant height max0.7 m
Plant height min0.1 m
Seed length2.46 mm
Seed mass0.32 mg
⚠ sources differ — TRY: 0.32 mg · LEDA: 0.391 mg · GIFT: 0.347 mg
Seed mass max0.4 mg
Seed mass min0.28 mg
Seed volume0.27 mm³
Seed volume max0.27 mm³
Seed volume min0.27 mm³
Life cycle & reproduction14
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
Flowering endAug
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number282
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTforest, meadows, mountains, old fields, plains, roadsides
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio18.85 g/g
Leaf c405 mg/g
Leaf dry-matter content (LDMC)158 mg/g
⚠ sources differ — TRY: 158 mg/g · LEDA: 137 mg/g
Leaf n21.76 mg/g
Leaf p1.61 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.79 mm²/mg
Wood density47.77 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition13 compounds
Compounds documented for Plantago media across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Iridoids monoterpenoids10
Cinnamic acids and derivatives $ Phenylethanoids1
Cinnamic acids and derivatives1
Cinnamic acids and derivatives $ Simple phenolic acids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4R,5R,6S)-2-[[(1S,4aS,5R,7aR)-4a,5-dihydroxy-7-(hydroxymethyl)-5,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5R,6R)-2-[[(1S,4aS,5R,7aS)-5-hydroxy-7-(hydroxymethyl)-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4R,5S,6R)-2-[[(1R,4aR,5R,7aR)-5-hydroxy-7-(hydroxymethyl)-4a-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5S,6R)-2-[[(1S,4aR,5R,7aR)-4a,5-dihydroxy-7-(hydroxymethyl)-5,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| 2-[[5-hydroxy-7-(hydroxymethyl)-4a-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| [(1S,4aS,5R,7aR)-4a,5-dihydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,7a-dihydro-1H-cyclopenta[c]pyran-7-yl]methyl acetate | present | LOTUS | |
| [(1S,4aS,5R,7aS)-4a,5-dihydroxy-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,7a-dihydro-1H-cyclopenta[c]pyran-7-yl]methyl acetate | present | LOTUS | |
| [(2S,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | LOTUS | |
| Aucubin | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plantago media has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections21
Countries9
The DNA barcodea real sequence read deposited for this species
GCCAAGGAAAACCAAATGGAAGCGTTACTCCTCTTAACTCCCGTTCGCGGTGCGGTTTGGGGATGTGATGTATCTGAAAGTCTAAACGAC …
Plantago media voucher GLM-F135032 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL4★rbcLa★ITS3★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Plantago media carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 562 360 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Plantago media2.56 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy4× tetraploid · measured
Chromosome records12–242n range24median24mode70records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2452×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — LOEVE A. - 1966. IOPB chromosome number reports VI.. Taxon , 15(3): 117-128.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.
CCDB · slov-fl — Letz R., Uhríková A. & Májovský J., 1999: Chromosome numbers of several interesting taxa of the flora of Slovakia. - Biologia (Bratislava) 54/1: 43-49.
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · iber-fl — The distribution of diploid and tetraploid cytotypes of Plantago media in the Pyrenees. Van Diijk, P.Monogr. Inst. Piren. Ecol.5: 331-335(1990).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3553
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · poland — Czapska D. 1959. Cytological and morphological studies in Plantago media L. and other species of the genus Plantago. Acta Soc. Bot. Pol. 28, 129-142.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Letz, R., A. Uhríková & J. Májovský. 1999. Chromosome numbers of several interesting taxa of the flora of Slovakia. Biologia (Bratislava) 54: 43–49.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., E. KLIPHUIS, & K.U. KRAMER. 1970. Zytotaxonomische Untersuchungen an Blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — BASSETT, I.J. 1967. Taxonomy of Plantago L. in North America: sections Holopsyllium Pilger, Palaeo.psyllium Pilger, and Lamprosantha Decne. Canad. Jour. Bot. 45: 565-577.
CCDB · book-ipcn75-78 — Sopova & Rizova 1975
CCDB · book-ipcn75-78 — Rahn 1976
CCDB · book-ipcn75-78 — Kliphuis 1977
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn75-78 — Zemskova 1977
CCDB · book-ipcn73-74 — KOZUHAROV, S.I., & A.V. PETROVA. 197 4. In IOPB chromosome reports XLIV. Taxon 23: 373-380.
CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.
CCDB · kew — Sen S, Sharma AK. 1990. Chromosome complements, nuclear DNA and genetic distance as measures of interrelationship in Plantago. The Nucleus 33: 4-10.
CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1985). Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 6: 3-8.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.
CCDB · CromoCat 2015 — Kliphuis, E. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 267-268.
+8 more references
2n 1218×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +6
CCDB · ita-fl — GIORDANI A., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:789-793.. Inform. Bot. Ital. , 12(3): 327-332.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Micelli, P. & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 787-793. Inform. Bot. Ital. 12: 327–332.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — BORHIDI, A. 1968. Karyological studies on southeast European plant species. I. Acta Bot. Acad. Sci. Hung. 14: 253-260.
CCDB · book-ipcn67-71 — BASSETT, I.J. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
CCDB · book-ipcn75-78 — Zemskova 1977
CCDB · book-ipcn75-78 — Kartashova et al. 1974
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · CromoCat 2015 — Kartashova, N. N., Malakhova, L. A., Koslova, A. A. & Dubrova, N. A. (1974b). Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk 47-53.
CCDB · CromoCat 2015 — Rahn, K. (1966). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports VI]. Taxon 15(2): 117-128.
CCDB · CromoCat 2015 — Van Dijk, P. (1990). The distribution of diploid and tetraploid cytotypes of Plantago media in the Pyrenees. Monogr. Inst. Piren. Ecol. 5: 331-335.
CCDB · CromoCat 2015 — Cheshmedziev, I. V. (1994). Reports (313-366). Fl. Medit. 4: 269-279.
n 123×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · Cave1963
CCDB · book-ipcn67-71 — TESSENE, M.F. 1969. systematic and ecological studies on Plantago cordata. Michigan Bot. 8: 72-103.
CCDB · book-ipcn75-78 — Vasudevan 1976
CCDB · Cave1963 — Sorsa 1963c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelContig
07Deep time2.58–1.8 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range2.58–1.8 Ma Pleistocene
Dated fossil finds1
StatusNot recorded since 1.8 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Plantago media. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type324 639 records
Wild obs. + sensor311 897
Museum / vouchered9 307
Cultivated / captive657
Fossil1
Other2 777
Origin
Native13 719
Introduced157
Range
Area of Occupancy AOO342 400 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 62 589≤1 km 35 351≤10 km 132 986>10 km 2 598
233 524 georeferenced · 78 373 without coordinates
Open the mapobservation + sensor311 897
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 658≤1 km 2 285≤10 km 3 749>10 km 269
6 961 georeferenced · 2 346 without coordinates
Open the institutions mapphysical evidence9 307
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤100 m 1≤1 km 1≤10 km 3>10 km 9
14 georeferenced · 643 without coordinates
Open the mapnot free-living657
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions89 of 192 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 280 |
| Moscow State Universitylocation not on record | 610 |
| Olocation not on record | 387 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 373 |
| LDlocation not on record | 346 |
| Salzburg, AT | 252 |
| BRNUlocation not on record | 210 |
| Trondheim, NO | 149 |
| MeiseBGlocation not on record | 147 |
| Kuopio, FI | 146 |
| Uniwersytet Warszawskilocation not on record | 134 |
| Oskarshamn, SE | 103 |
| SLU Artdatabankenlocation not on record | 98 |
| Tartu, EE | 93 |
| Uniwersytet Śląski w Katowicachlocation not on record | 92 |
| Oulu, FI | 92 |
| BDBClocation not on record | 89 |
| Turku, FI | 83 |
| Adam Mickiewicz University in Poznańlocation not on record | 83 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 77 |
| Barcelona, ES | 65 |
| BIO-UNIPIlocation not on record | 55 |
| Philadelphia, US | 52 |
| Entomological Society of Latvialocation not on record | 51 |
| Beijing, CN | 50 |
| València, ES | 48 |
| KMNlocation not on record | 44 |
| MAlocation not on record | 40 |
| TROMlocation not on record | 36 |
| BFLlocation not on record | 34 |
| Provincia di Livornolocation not on record | 33 |
| Tallinn, EE | 32 |
| Görlitz, DE | 31 |
| Uppsala, SE | 31 |
| Jyväskylä, FI | 30 |
| Frankfurt am Main | 29 |
| Bergen, NO | 27 |
| Vitoria, ES | 26 |
| BClocation not on record | 25 |
| Pamplona, ES | 24 |
| South Kensington, GB | 23 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 23 |
| Berlin, DE | 21 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Wlocation not on record | 19 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Helsinki, FI | 16 |
| Madrid, ES | 16 |
| Tula State Universitylocation not on record | 15 |
| Salamanca, ES | 15 |
| TUR-Alocation not on record | 15 |
| Mlocation not on record | 15 |
| Granada, ES | 14 |
| UniKSlocation not on record | 14 |
| CICYTEXlocation not on record | 13 |
| Bern, CH | 12 |
| Université Lavallocation not on record | 12 |
| Porrentruy, CH | 12 |
| SWlocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| DBF-NHMDlocation not on record | 10 |
| Phyletisches Museum Jenalocation not on record | 10 |
| GJOlocation not on record | 10 |
| Porvoo, FI | 10 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 9 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Québec, CA | 8 |
| Pamplona, ES | 8 |
| Stockholm, SE | 8 |
| Yangling, CN | 8 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 7 |
| Kandalaksha State Nature Reservelocation not on record | 7 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Podgorica, ME | 7 |
| Nanjing, CN | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Uniwersytet w Białymstokulocation not on record | 6 |
| New Haven, US | 6 |
| Tilburg, NL | 6 |
| University of New Hampshirelocation not on record | 5 |
| Dresden, DE | 5 |
| National Museum Waleslocation not on record | 5 |
| GZUlocation not on record | 5 |
| Toronto, CA | 5 |
| NMBU:MINAlocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Winterthur, CH | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| OLAlocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Bloomington, US | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Glarus, CH | 4 |
| SVK001location not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Forssa, FI | 3 |
| BGBMlocation not on record | 3 |
| Sevilla, ES | 3 |
| Alicante, ES | 3 |
| Montréal, CA | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Fulda, DE | 3 |
| Staten Island, US | 3 |
| Bourges, FR | 3 |
| CZE061location not on record | 3 |
| HUN003location not on record | 3 |
| Wellington, NZ | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Kew, GB | 2 |
| Bronx, US | 2 |
| Madison, US | 2 |
| ESP109location not on record | 2 |
| Sion, CH | 2 |
| Dekalb, US | 2 |
| Ann Arbor, US | 2 |
| Yugra State University Biological Collectionlocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Guangzhou, CN | 2 |
| WNNUlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| PRClocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Monastir, TN | 2 |
| Karlsruhe, DE | 2 |
| Zürich, CH | 2 |
| Durham, US | 2 |
| BSBIlocation not on record | 2 |
| Blumenau, BR | 2 |
| Zürich, CH | 1 |
| Auckland, NZ | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Xiamen, CN | 1 |
| UNINE:NEUlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Flagstaff, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| nbflocation not on record | 1 |
| UFSClocation not on record | 1 |
| Philadelphia, US | 1 |
| Edinburgh, GB | 1 |
| Boumlocation not on record | 1 |
| Saint Louis, US | 1 |
| Missoula, US | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| SZUlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Nijmegen, NL | 1 |
| FLADlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| FJIDClocation not on record | 1 |
| New Brunswick, US | 1 |
| Banyoles, ES | 1 |
| Victoria, CA | 1 |
| Denton, US | 1 |
| Urumqi, CN | 1 |
| Sant Julià de Lòria, AD | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| UIBlocation not on record | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Bangkok, TH | 1 |
| Logan, US | 1 |
| Paris, FR | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Coimbra, PT | 1 |
| Chengdu, CN | 1 |
| Badajoz, ES | 1 |
| CJBNlocation not on record | 1 |
| Gijón, ES | 1 |
| Göteborg, SE | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Jaén, ES | 1 |
| Davis, US | 1 |
| SVN019location not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| ROM020location not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
192 institutions · 8 333 of 9 307 vouchered records shown · 920 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Plantago media was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map4 countries0
chalk meadowgrassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 8.70–20.6
Seasonal swing summer↔winter14.9 °C
Max temp (day)18.9 °C 11.7–25.8
Min temp (night)11.8 °C 4.90–16.3
Precipitation80.4 mm/mo 57.3–97.0
Air humidity62.1 % 57.5–65.4
Moisture balance-13.1 mm/mo -64.7–36.9
Vapour deficit675 Pa 418–1,035
Wind speed3.60 m/s 2.50–5.40
Cloud cover46.3 % 37.9–50.0
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.