Plantago lanceolata
speciesAt a glance
Occurrence records1 673 135
Data sources13
Biological traits86
DNA specimens134
eDNA detections197
Sources13 archives
Databases and archives Plantago lanceolata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 673 133 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI197 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics134 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources86 traits
Chemical compositionLOTUS · NPASS196 compounds
Occurrence & distributionGBIF · PBDB1 673 135 records
Environmental DNA5 datasets · 22 countries197 detections
DNA & barcodingBOLD · NCBI134 specimens
Genome at a glanceCCDB · GoaT · NCBI1.4 Gbp
Deep timePBDB2 fossils
01Narrative
Plantago lanceolata, le Plantain lancéolé, Plantain étroit ou « Herbe à cinq coutures ou à cinq côtes » est une plante herbacée vivace de la famille des Plantaginacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology33
Fruit length3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 3 mm
Fruit length max4 mm
Fruit length min2.5 mm
Fruit width2.25 mm
Fruit width max2.2 mm
Fruit width min1.8 mm
Inflorescence length max5 cm
Inflorescence length min0.5 cm
Leaf length115 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf mass263 mg
⚠ sources differ — AusTraits: 263 mg · LEDA: 78.34 mg
Leaf mass per area97.0 g/m2
Leaf size1 739 mm²
⚠ sources differ — TRY: 1 739 mm² · AusTraits: 3 637 mm² · LEDA: 2 567 mm² · GIFT: 2 567 mm²
Leaf width17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 27 mm
Leaf width max30 mm
Leaf width min5 mm
Petiole length5.5 cm
Plant height0.278 m
⚠ sources differ — GIFT: 0.278 m · AusTraits: 0.475 m · LEDA: 0.15 m · TRY: 0.172 m
Plant height generative0.32 m
Plant height max0.9 m
Plant height min0.01 m
Seed length1.68 mm
⚠ sources differ — TRY: 1.68 mm · AusTraits: 3 mm · GIFT: 2.5 mm
Seed length max3 mm
Seed length min2 mm
Seed mass1.45 mg
⚠ sources differ — TRY: 1.45 mg · AusTraits: 1.3 mg · LEDA: 1.81 mg · GIFT: 1.42 mg
Seed mass max2.02 mg
Seed mass min0.29 mg
Seed volume2.2 mm³
Seed volume max2.9 mm³
Seed volume min1.8 mm³
Seed width max1.5 mm
Seed width min0.8 mm
Life cycle & reproduction20
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal+wind
⚠ sources differ — AusTraits: anemochory zoochory · LEDA: endozoochor · GIFT: anemochorous
Flower colourbrown
Flower length max3 mm
Flower length min2 mm
Flowering endApr
Flowering startApr
Flowering timeyyyynnnnyyyy
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual biennial · LEDA: perennials · GIFT: perennial
Lifespan years3.3 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number618
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean1 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical lanceolate
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio24.85 g/g
Leaf c433 mg/g
Leaf dry-matter content (LDMC)186 mg/g
⚠ sources differ — TRY: 186 mg/g · LEDA: 162 mg/g
Leaf n20.46 mg/g
Leaf p2.35 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.61 mm²/mg
Wood density66.72 mg/cm³
Other traits4
Diaspore typeone-seeded generative dispersule
Inflorescencespike
Leaf arrangementrosette
Seeds per fruit>1000
03Chemical composition196 compounds
Compounds documented for Plantago lanceolata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cardenolides46
Cinnamic acids and derivatives $ Phenylethanoids19
Iridoids monoterpenoids17
Ursane and Taraxastane triterpenoids15
Cytochalasan alkaloids11
Documented compounds196 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((2R,3R,4S,5R,6R)-2,5-dihydroxy-6-(hydroxymethyl)-3-(3,4,5-trihydroxybenzoyl)oxy-tetrahydropyran-4-yl) 3,4,5-trihydroxybenzoate | present | LOTUS | |
| ((2R,3R,4S,5R,6R)-6-(2-(3,4-dihydroxyphenyl)ethoxy)-3,5-dihydroxy-4-((2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl)methyl (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | LOTUS | |
| (+)-Ursolic Acid | present | NPASS | |
| (1aS,1bS,2S,5aR,6S,6aS)-1a,1b,2,5a,6,6a-Hexahydro-6-hydroxy-1a-(hydroxymethyl)oxireno[4,5]cyclopenta[1,2-c]pyran-2-yl-beta-D-glucopyranoside | present | LOTUS | |
| (1R,2R,4aR,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bR)-2,10-dihydroxy-1,2,6a,6b,9,9,12a-heptamethyl-1,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-tetradecahydropicene-4a-carboxylic acid | present | NPASS | |
| (1R,3aS,5aR,5bR,7aR,11aS,11bR,13aR,13bR)-3a-(hydroxymethyl)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,7,7a,10,11,11b,12,13,13a,13b-tetradecahydrocyclopenta[a]chrysene-6,9-dione | present | NPASS | |
| (1R,3S,3aR,5aR,5bR,7aR,9R,11bR,13aR,13bR)-3,9-dihydroxy-3a-(hydroxymethyl)-5a,5b,8,8-tetramethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,11b,12,13,13a,13b-tetradecahydrocyclopenta[a]chrysen-10-one | present | NPASS | |
| (1R,4aR,6aR,6aR,6bR,8aR,10S,12aS,13S,14R,14aR,14bS)-14-hydroxy-10-(4-hydroxyphenoxy)-13-methoxy-1,2,6a,6b,9,9,12a-heptamethyl-4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-tetradecahydro-1H-picene-4a-carboxylic acid | present | NPASS | |
| (1R,4E,6R,10R,12E,14S,17S,18S,19S)-19-benzyl-6-hydroxy-10,16,17-trimethyl-2-oxa-20-azatricyclo[12.7.0.01,18]henicosa-4,12,15-triene-3,21-dione | present | NPASS | |
| (1S,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14bS)-10-hydroxy-4a-[[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxymethyl]-1,2,6b,9,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-6a-carboxylic acid | present | NPASS |
05DNA & barcoding134 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plantago lanceolata has left across the world's sequence archives.
At a glance
DNA specimens134
Marker genes8
GenBank sequences10
eDNA detections197
Countries22
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCC …
Plantago lanceolata voucher PLT.0341 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Plantago lanceolata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 437 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Plantago lanceolata1.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records6–242n range12median12mode180records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 12165×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — PERUZZI L. - 2003. Reports 1344-1347. In: Kamari G., Blanch C., Garbari F. (Eds.). Mediterranean chromosome number reports 13. Flora Medit. , 13: 370-373.
CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C. - 1985. Considerazioni cariologiche sul genere Plantago in Sicilia.. Candollea , 40(1): 217-230.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Hindáková M. & Záborský J., 1977: [Report], pp. 262. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.
CCDB · slov-fl — Murín A., 1997: Karyotaxonomy of some medicinal and aromatic plants. - Thaiszia - J. Bot., Košice 7: 75-88.
CCDB · slov-fl — Leskovjanská A., 2007: [New records in Cirsium, Eupatorium, Lapsana, Leontodon, Medicago, Melilotus, Plantago, Salvia, Senecio, Silene, Sonchus, Tanacetum, Thlaspi, Trifolium, and Veronica], pp. 195, 251, 355, 359, 384, 387, 453, 518, 536, 549, 555, 568, 582, 592, 603. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. VI. Plantaginaceae. Fernandes, A. & F. Frana.Bol. Soc. Brot. ser. 246: 465-501(1972).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Mis contribuciones al estudio de la flora asturiana. Lanz, M.Inst. Estud. Asturianos Oviedo(1982).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 157-163. Castroviejo, S.Anales Jard. Bot. Madrid38(2): 507-513(1982).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 141-149. Gonzlez, F. & S. Silvestre.Lagascalia9(2): 261-266(1980).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3554
CCDB · new-zealand40
CCDB · poland — Czapska D. 1959. Cytological and morphological studies in Plantago media L. and other species of the genus Plantago. Acta Soc. Bot. Pol. 28, 129-142.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Castroviejo, S. 1982. Numeros cromosomaticos de plantas occidentales: 157-163. Anales Jard. Bot. Madrid 38: 507–514.
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
CCDB · ipcn-api-dl — Sharma, P. K., A. K. Koul & A. LANGER. 1984. Genetic diversity among Plantagos II. Karyotype of Plantago lanceolata L. with special emphasis on nucleolar chromosomes. Cytologia 49: 351–357.
CCDB · ipcn-api-dl — D'Ovidio, R. 1984. Numeri cromosomici per la flora Italiana: 1011--1021. Inform. Bot. Ital. 16: 251–260.
CCDB · ipcn-api-dl — Badr, A. & M. A. El-Kholy. 1987. Chromosomal studies in the Egyptian flora II. Karyotype studies in the genus Plantago L. Cytologia 52: 725–731.
CCDB · ipcn-api-dl — Brown, M. J. & W. D. Jackson. 1982. In: IOPB chromosome number reports LXXV. Taxon 31: 367–368.
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Matsuo, K. & J. Noguchi. 1989. Karyotype analysis of several Plantago species in Japan, with special reference to the taxonomic status of Plantago japonica. J. Phytogeogr. Taxon. 37: 27–35.
CCDB · ipcn-api-dl — Sareen, S., A. K. Koul & A. LANGER. 1990. Genetic diversity among plantagos XI. Karyotype polymorphism in Plantago lanceolata L. CIS Chromosome Inform. Serv. 49: 13–15.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Sharma, N., P. Koul & A. K. Koul. 1992. Genetic systems of six species of Plantago (Plantaginaceae). Pl. Syst. Evol. 181: 1–9.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
+122 more references
2n 2412×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3
CCDB · ita-fl — MARCUCCI R., TORNADORE N. - 1997 (1996). Numeri Cromosomici per la Flora Italiana.. Inform. Bot. Ital. , 28(2): 256-266.
CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C. - 1985. Considerazioni cariologiche sul genere Plantago in Sicilia.. Candollea , 40(1): 217-230.
CCDB · ipcn-api-dl — Lessani, H. & S. Chariat-panahi. 1979. In IOPB chromosome number reports LXV. Taxon 28: 635–636.
CCDB · book-ipcn66 — Rahn 1966
CCDB · book-ipcn73-74 — RAHN, K. 1974. Plantago section Virginica. Dansk. Bot. Ark. 30, 2: 1-180.
CCDB · Cave1957 — Rahn
CCDB · CromoCat 2015 — Bartolo, G., S. Brullo, P. Pavone & M. C. Terrasi. (1980). Contributo alla cariologia del genere Plantago in Sicilia e Calabria meridionale. Giorn. Bot. Ital. 114: 100.
CCDB · CromoCat 2015 — Brullo, S., Pavone, P. & Terrasi, M. C. (1985). Considerazioni cariologiche sul genere Plantago in Sicilia. Candollea 40: 217-230.
CCDB · CromoCat 2015 — Lessani, H. & Chairat-Panahi, S. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 635-636.
CCDB · CromoCat 2015 — Murín, A. (1997). Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75-88.
2n 132×CCDB · Cave1959 · CCDB · CromoCat 2015
CCDB · Cave1959 — Soyano, 1959
CCDB · CromoCat 2015 — Munshi, A., S. Sareen, A. Langer & A. K. Koul (1995). Cytogenetics studies on primary trisomics of Plantago lanceolata L. Proc. Indian Natl. Sci. Acad., Part B, Biol. Sci. 61:339-346
2n 142×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Munshi, A., A. LANGER & A. K. Koul. 1994. A novel aneuploid in Plantago lanceolata L. Nucleus (Calcutta) 37(1,2): 23–24.
CCDB · CromoCat 2015 — Munshi, A., A. Langer & A. K. Koul (1994). A novel aneuploid in Plantago lanceolata L. Nucleus 37(1,2): 23-24
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
2n 61×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BAQUAR, S.R., & S.H. ABID ASKARI. 1970. Chromosome numbers in some flowering plants of West Pakistan. Genet. Iber. 22: 1-11.
n 634×CCDB · iapt · CCDB · iber-fl · CCDB · ipcn-api-dl +5
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 141-149. Gonzlez, F. & S. Silvestre.Lagascalia9(2): 261-266(1980).
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Sharma, P. K. & A. K. Koul. 1982. Genetic diversity among plantagos, I. Desynapsis. Nucleus (Calcutta) 25: 10–13.
CCDB · ipcn-api-dl — Sharma, P. K., A. K. Koul & A. LANGER. 1984. Genetic diversity among Plantagos II. Karyotype of Plantago lanceolata L. with special emphasis on nucleolar chromosomes. Cytologia 49: 351–357.
CCDB · ipcn-api-dl — Sharma, N., P. Koul & A. K. Koul. 1992. Genetic systems of six species of Plantago (Plantaginaceae). Pl. Syst. Evol. 181: 1–9.
CCDB · ipcn-api-dl — Sharma, N. & A. K. Koul. 1995. Reproductive strategies in weeds---Plantago major, P. lanceolata and their cultivated ally P. ovata. Proc. Indian Natl. Sci. Acad., B 61: 471–478.
CCDB · ipcn-api-dl — Malallah, G. A. & G. Brown. 1999. Determination of chromosome number of Kuwaiti flora I. Cytologia 64: 181–196.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Aryavand, A. 1980. In chromosome number reports LXIX. Taxon 29:704.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — BAQUAR, S.R., & S.H. ABID ASKARI. 1970. Chromosome numbers in some flowering plants of West Pakistan. Genet. Iber. 22: 1-11.
CCDB · book-ipcn67-71 — BAQUAR, S.R. & S.H. ABID ASKARI. 1970. Chromosome studies in some flowering plants of West Pakistan. II. Genet. Iber. 22: 41-51.
CCDB · book-ipcn75-78 — Vasudevan 1976
CCDB · Cave1956supp — Ono 1954b
CCDB · Cave1963 — Sorsa 1963c; Heiser 1963a
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970a). Chromosome numbers in some flowering plants of West Pakistan. Genét. Ibér. 22: 1-11.
CCDB · CromoCat 2015 — Baquar, S. R. & Abid Askari, S. H. (1970b). Chromosome studies in some flowering plants of West Pakistan. II. Genét. Ibér. 22: 41-51.
CCDB · CromoCat 2015 — Favarger, C. & Vasudevan, K. N. (1972). Étude cytologique et morphologique des populations de Plantago major L. et de Plantago lanceolata L. de l`Himalaya occidental. Comparaison avec des plantes de Suisse. Bull. Soc. Neuchât. Sci. Nat. 95: 63-74.
CCDB · CromoCat 2015 — González, F. & Silvestre, S. (1980). Números cromosómicos para la flora española, 141-149. Lagascalia 9(2): 261-266.
CCDB · CromoCat 2015 — Hill, L. M. (1984). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXXIV]. Taxon 33(3): 537.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
CCDB · CromoCat 2015 — Sharma, N. & A. K. Koul (1995). Reproductive strategies in weeds-Plantago major, P. lanceolata and their cultivated ally P. ovata. Proc. Indian Natl. Sci. Acad., Part B, Biol. Sci. 61:471-478
CCDB · CromoCat 2015 — Sharma, N., P. Koul & A. K. Koul (1992). Genetic systems of six species of Plantago (Plantaginaceae) Plant Systematics and Evolution 181: 1-9
CCDB · CromoCat 2015 — Sharma, P. K. & A. K. Koul (1982). Genetic diversity among plantagos, I. Desynapsis Nucleus 25: 10-13
CCDB · CromoCat 2015 — Sharma, P. K., A. K. Koul & A. Langer (1984). Genetic diversity among Plantagos II. Karyotype of Plantago lanceolata L. with special emphasis on nucleolar chromosomes Cytologia 49: 351-357
CCDB · CromoCat 2015 — Sorsa, V. (1963b). Chromosomenzahlen Finnischer Kormophyten, II. Ann. Acad. Sci. Fenn., Sér. A 68: 1-14.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Taylor, R. L. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XIX]. Taxon 17(5): 577.
CCDB · CromoCat 2015 — Vasudevan, K. N. (1976). Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alpes). Part III. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 86: 152-203.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 122×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Faasen & Nadeau 1976
CCDB · CromoCat 2015 — Faasen, P., van & Nadeau, P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 156-158.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
07Deep time2.58–0 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range2.58–0 Ma Pleistocene, Holocene
Dated fossil finds2
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Plantago lanceolata. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type1 673 135 records
Wild obs. + sensor1 629 156
Museum / vouchered34 778
Cultivated / captive3 101
Fossil21
Other6 079
Origin
Native65 750
Introduced37 305
Range
Area of Occupancy AOO1 084 896 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 371 859≤1 km 285 003≤10 km 668 923>10 km 8 789
1 334 574 georeferenced · 294 582 without coordinates
Open the mapobservation + sensor1 629 156
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 2 972≤1 km 7 337≤10 km 12 559>10 km 572
23 440 georeferenced · 11 338 without coordinates
Open the institutions mapphysical evidence34 778
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 2≤10 km 9>10 km 15
26 georeferenced · 3 075 without coordinates
Open the mapnot free-living3 101
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions292 of 552 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 12 321 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 691 |
| BIO-UNIPIlocation not on record | 743 |
| BFLlocation not on record | 702 |
| LDlocation not on record | 596 |
| Berlin, DE | 583 |
| Olocation not on record | 572 |
| Moscow State Universitylocation not on record | 566 |
| Philadelphia, US | 403 |
| Salzburg, AT | 378 |
| MeiseBGlocation not on record | 343 |
| BRNUlocation not on record | 312 |
| Trondheim, NO | 278 |
| Adelaide, AU | 250 |
| Chongqing Museumlocation not on record | 241 |
| Uniwersytet Warszawskilocation not on record | 217 |
| Turku, FI | 211 |
| Bergen, NO | 189 |
| Uniwersytet Śląski w Katowicachlocation not on record | 176 |
| Pretoria, ZA | 168 |
| Kuopio, FI | 164 |
| Wuzhou, CN | 163 |
| Oskarshamn, SE | 156 |
| Museo Entomologico de Leonlocation not on record | 153 |
| San Diego, US | 148 |
| Odawara, JP | 142 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 137 |
| WTUlocation not on record | 133 |
| INTAlocation not on record | 128 |
| Claremont, US | 127 |
| MAlocation not on record | 125 |
| SLU Artdatabankenlocation not on record | 125 |
| Mount Annan, AU | 122 |
| Saint Louis, US | 119 |
| Riverside, US | 119 |
| UniKSlocation not on record | 118 |
| Adam Mickiewicz University in Poznańlocation not on record | 113 |
| Görlitz, DE | 112 |
| València, ES | 110 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 109 |
| Bloomington, US | 107 |
| Canberra, AU | 105 |
| Québec, CA | 104 |
| Oulu, FI | 103 |
| Tartu, EE | 102 |
| CICYTEXlocation not on record | 101 |
| Brisbane, AU | 99 |
| Santa Barbara, US | 96 |
| Barcelona, ES | 94 |
| Ann Arbor, US | 92 |
| Entomological Society of Latvialocation not on record | 91 |
| Pullman, US | 91 |
| Wlocation not on record | 90 |
| College Park, US | 90 |
| TUR-Alocation not on record | 87 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 87 |
| South Kensington, GB | 86 |
| BDBClocation not on record | 84 |
| Madison, US | 84 |
| Toyama, JP | 82 |
| KMNlocation not on record | 81 |
| Auckland, NZ | 80 |
| Hobart, AU | 78 |
| Bronx, US | 76 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 74 |
| TROMlocation not on record | 72 |
| Chiba, JP | 71 |
| Christchurch, NZ | 70 |
| Davis, US | 68 |
| Angwin, US | 67 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 66 |
| Corvallis, US | 65 |
| Garðabær, IS | 65 |
| University of Stellenboschlocation not on record | 63 |
| Kensington, AU | 62 |
| Uniwersytet Opolskilocation not on record | 62 |
| Moscow, US | 62 |
| Acadia Universitylocation not on record | 61 |
| Vitoria, ES | 59 |
| Flagstaff, US | 58 |
| Arcata, US | 57 |
| Philadelphia, US | 57 |
| Madrid, ES | 57 |
| San Luis Obispo, US | 57 |
| Provincia di Livornolocation not on record | 57 |
| Bern, CH | 54 |
| Pamplona, ES | 53 |
| Wellington, NZ | 53 |
| BClocation not on record | 53 |
| Burlington, US | 49 |
| New Haven, US | 48 |
| Nagano City, JP | 48 |
| Williamsburg, US | 47 |
| Montréal, CA | 46 |
| GMBAlocation not on record | 46 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 45 |
| Badajoz, ES | 45 |
| Bangkok, TH | 44 |
| Uppsala, SE | 44 |
| Canadian Department of Agriculturelocation not on record | 43 |
| US | 43 |
| Tallinn, EE | 42 |
| Bando, JP | 41 |
| Shinshu Universitylocation not on record | 41 |
| Salamanca, ES | 41 |
| University of New Hampshirelocation not on record | 38 |
| Pittsburg, US | 38 |
| Beijing, CN | 37 |
| Fukushima Universitylocation not on record | 36 |
| Kew, GB | 36 |
| Jyväskylä, FI | 36 |
| St. Paul, US | 35 |
| Denver, US | 34 |
| Santa Cruz, US | 33 |
| Albuquerque, US | 33 |
| Armidale, AU | 32 |
| McWane Science Centerlocation not on record | 32 |
| Allentown, US | 31 |
| Mlocation not on record | 31 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 31 |
| Córdoba, ES | 30 |
| DOI/NPS, Greenbelt Parklocation not on record | 30 |
| Université Lavallocation not on record | 30 |
| College of the Atlantic, Museumlocation not on record | 30 |
| Mexico City, MX | 29 |
| Frankfurt am Main | 28 |
| Phyletisches Museum Jenalocation not on record | 28 |
| Mexico City, MX | 28 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 27 |
| Tampa, US | 27 |
| Granada, ES | 27 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 27 |
| Durango, MX | 26 |
| Missoula, US | 26 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 26 |
| Paris, FR | 26 |
| Zürich, CH | 26 |
| Durban, ZA | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| EL PASO, US | 24 |
| Jackson, US | 24 |
| Karlsruhe, DE | 24 |
| ASUlocation not on record | 23 |
| Tuscaloosa, US | 23 |
| BISHlocation not on record | 23 |
| Córdoba, AR | 23 |
| Austin, US | 23 |
| Kawasaki Shi Tama Ku, JP | 22 |
| Millersville, US | 22 |
| Boise, US | 22 |
| San Isidro, AR | 22 |
| New Brunswick, US | 22 |
| UGentlocation not on record | 22 |
| Helsinki, FI | 22 |
| Fort Worth, US | 21 |
| Logan, US | 21 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 21 |
| Norfolk, US | 21 |
| Tsukuba, JP | 20 |
| Toronto, CA | 20 |
| Otaru, JP | 20 |
| Rotorua, NZ | 19 |
| Valdosta State Universitylocation not on record | 19 |
| Stockholm, SE | 19 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 19 |
| Zürich, CH | 19 |
| GAlocation not on record | 18 |
| 18 | |
| JP | 18 |
| NSMKlocation not on record | 17 |
| Chapel Hill, US | 17 |
| Miami, US | 17 |
| Pamplona, ES | 17 |
| Kochi, JP | 17 |
| GJOlocation not on record | 17 |
| Sanda, JP | 17 |
| Cape Town, ZA | 17 |
| Morgantown, US | 17 |
| Tomioka, JP | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| Green Bay, US | 16 |
| Alicante, ES | 16 |
| Portland, US | 15 |
| Nagatoro-machi, Chichibu-gun, JP | 15 |
| Provo, US | 15 |
| Emporia, US | 15 |
| Phoenix, US | 14 |
| Vancouver, CA | 14 |
| Victoria, CA | 14 |
| Bozeman, US | 14 |
| Porrentruy, CH | 14 |
| Hiratsuka City Museumlocation not on record | 14 |
| Valparaíso, CL | 14 |
| KURAlocation not on record | 13 |
| Kunming, CN | 13 |
| Severin-McDaniel Insect Collectionlocation not on record | 13 |
| Honolulu, US | 13 |
| Mississippi State, US | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Knoxville, US | 13 |
| Taipei, TW | 13 |
| UChlocation not on record | 13 |
| Pocatello, US | 13 |
| Columbia, US | 13 |
| Durango, US | 12 |
| Dekalb, US | 12 |
| Torreón, MX | 12 |
| Lord Fairfax Community Collegelocation not on record | 12 |
| Porvoo, FI | 12 |
| Keene State Universitylocation not on record | 12 |
| Turlock, US | 12 |
| Chadron, US | 12 |
| Staten Island, US | 12 |
| Jena Microbial Resource Collectionlocation not on record | 12 |
| John T. Waterhouse Herbariumlocation not on record | 11 |
| UIBlocation not on record | 11 |
| University of Tennessee at Chattanoogalocation not on record | 11 |
| DBF-NHMDlocation not on record | 11 |
| Irvine, US | 11 |
| Caldwell, US | 11 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 11 |
| Northridge, US | 11 |
| CASlocation not on record | 10 |
| Spearfish, US | 10 |
| Fayetteville, US | 10 |
| Xiamen, CN | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| BSBIlocation not on record | 10 |
| Blumenau, BR | 10 |
| Lincoln, US | 10 |
| Tacoma, US | 9 |
| US | 9 |
| San Francisco, US | 9 |
| BAYLUlocation not on record | 9 |
| Saint John, CA | 9 |
| Urumqi, CN | 9 |
| KOMlocation not on record | 9 |
| CZE061location not on record | 9 |
| Museum of the Rockieslocation not on record | 9 |
| Whitewater, US | 9 |
| Museo Achille Folettolocation not on record | 9 |
| Kirksville, US | 9 |
| Kingston, US | 9 |
| Durham, US | 9 |
| Jaén, ES | 9 |
| Los Angeles, US | 9 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 8 |
| AZE015location not on record | 8 |
| Smithfield, AU | 8 |
| Laboratory of Palaeontologylocation not on record | 8 |
| University of Southern Mississippilocation not on record | 8 |
| PrivatHerblocation not on record | 8 |
| National Marine Biodiversity Institute of Korealocation not on record | 8 |
| Xinxiang, CN | 8 |
| Dresden, DE | 8 |
| DASSHlocation not on record | 8 |
| Kushiro City Museumlocation not on record | 8 |
| Sagamihara, JP | 8 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 8 |
| Sendai, JP | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| NMBU:MINAlocation not on record | 8 |
| Nanjing, CN | 8 |
| Rishon Le Zion, IL | 8 |
| Weber State Universitylocation not on record | 7 |
| Fullerton, US | 7 |
| Long Beach, US | 7 |
| EEZA-CSIClocation not on record | 7 |
| Chicago, US | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Tilburg, NL | 7 |
| Bend, US | 7 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| GZUlocation not on record | 7 |
| Nishihara, JP | 7 |
| J.F.Oberlin Universitylocation not on record | 7 |
| IDElocation not on record | 7 |
| University of Alberta Museumslocation not on record | 7 |
| Cheney, US | 6 |
| KR | 6 |
| Nishihara, JP | 6 |
| Tokushima, JP | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Aarhus, DK | 6 |
| University of Lethbridgelocation not on record | 6 |
| Fairfax, US | 6 |
| Iwate Prefectural Museumlocation not on record | 6 |
| Johnson City, US | 6 |
| China Agricultural Universitylocation not on record | 6 |
| Akita Prefectural Museumlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| GB | 6 |
| Davenport, US | 6 |
| AUAlocation not on record | 6 |
| Grand Junction, US | 6 |
| Palmerston, AU | 6 |
| Chicago, US | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| Corrientes, AR | 6 |
| Frauenfeld, CH | 6 |
| Clemson, US | 6 |
| Yangling, CN | 6 |
| Ashland, US | 6 |
| Bourges, FR | 6 |
| Hudson, US | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Lubbock, US | 5 |
| Washington, US | 5 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 5 |
| Mount Pleasant, US | 5 |
| PRClocation not on record | 5 |
| Fredericksburg, US | 5 |
| TAFORI-LSRClocation not on record | 5 |
| Podgorica, ME | 5 |
| CJBGlocation not on record | 5 |
| Wollongong, AU | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| San Jose, US | 5 |
| Ishikawa Museum of Natural Historylocation not on record | 5 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 5 |
| Truckee, US | 5 |
| Linares, MX | 5 |
| Orem, US | 5 |
| Richmond, US | 5 |
| Göteborg, SE | 5 |
| Parkville, AU | 5 |
| Awka, NG | 4 |
| QCNElocation not on record | 4 |
| OLAlocation not on record | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| CIBIOlocation not on record | 4 |
| Wuhan, CN | 4 |
| Guasave, MX | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| ESP109location not on record | 4 |
| Bothell, US | 4 |
| BGBMlocation not on record | 4 |
| Maringá, BR | 4 |
| Hamilton, US | 4 |
| Oswego, US | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Macomb, US | 4 |
| Ypsilanti, US | 4 |
| Chapingo, MX | 4 |
| KIRMlocation not on record | 4 |
| Uniwersytet w Białymstokulocation not on record | 4 |
| nbflocation not on record | 4 |
| Hebei Normal Universitylocation not on record | 4 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 4 |
| Sevilla, ES | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| NSW Office of Environment and Heritagelocation not on record | 4 |
| UFSClocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Fulda, DE | 3 |
| Winterthur, CH | 3 |
| HUN003location not on record | 3 |
| Guangzhou, CN | 3 |
| Montecillo, Texcoco, MX | 3 |
| Chengdu, CN | 3 |
| TAIElocation not on record | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| University of North Carolina at Pembrokelocation not on record | 3 |
| *unvoucheredlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 3 |
| KNAMlocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Springfield, US | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| JBSlocation not on record | 3 |
| Universite de Montpellierlocation not on record | 3 |
| Riobamba, EC | 3 |
| Cuenca, EC | 3 |
| Osaka, JP | 3 |
| Sucre, BO | 3 |
| US | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Criciúma, BR | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| La Trobe Universitylocation not on record | 3 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 3 |
| USP-IBlocation not on record | 3 |
| Juriquilla, MX | 3 |
| San Angelo, US | 3 |
| SIHUlocation not on record | 3 |
| GHPG$location not on record | 3 |
| QVMAGlocation not on record | 3 |
| UNESClocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Sion, CH | 3 |
| BGPAlocation not on record | 3 |
| Chicago, US | 2 |
| Quito, EC | 2 |
| HJAEFlocation not on record | 2 |
| UnBlocation not on record | 2 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 2 |
| Edinburgh, GB | 2 |
| UFSJlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Waverly, US | 2 |
| Ivano-Frankove, UA | 2 |
| Henderson, US | 2 |
| Loja, EC | 2 |
| ROM007location not on record | 2 |
| Whitehorse, CA | 2 |
| Urumqi, CN | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Banyoles, ES | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| KNFHClocation not on record | 2 |
| Xian, CN | 2 |
| Namur, BE | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Lanzhou, CN | 2 |
| Baltimore, US | 2 |
| Batemans Bay, AU | 2 |
| Taipei, TW | 2 |
| Valparaiso, CL | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Gijón, ES | 2 |
| AASlocation not on record | 2 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 2 |
| Pondicherry, IN | 2 |
| Memorial University of Newfoundlandlocation not on record | 2 |
| USFSlocation not on record | 2 |
| VALElocation not on record | 2 |
| Université de Strasbourglocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Bruce Peninsula National Parklocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| BMlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Cambridge, US | 2 |
| Glarus, CH | 2 |
| UoB-IBlocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| MMHNSRlocation not on record | 2 |
| Santiago, CL | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| Tlalnepantla, MX | 2 |
| Philadelphia, US | 2 |
| CUVClocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Universidade de São Paulolocation not on record | 2 |
| Little Rock, US | 2 |
| Elikins, US | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| H-Diaslocation not on record | 1 |
| Metsähallituslocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| US | 1 |
| Hermosillo, MX | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Jefferson City, US | 1 |
| ESP004location not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Minia, EG | 1 |
| Dover, US | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Conway, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| UTPLlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Feira de Santana, BR | 1 |
| ROM020location not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Conway, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Zhengzhou, CN | 1 |
| LINUlocation not on record | 1 |
| Puebla, MX | 1 |
| San Bernardino, US | 1 |
| IPA/SPlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| ENTClocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Sapporo, JP | 1 |
| Brock University (BU)location not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Clocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Durham, US | 1 |
| Fargo, US | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Nanjing, CN | 1 |
| DULlocation not on record | 1 |
| PLAlocation not on record | 1 |
| ESP003location not on record | 1 |
| Denton, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Academia de Ciencias de Cuba, Instituto de Zoologialocation not on record | 1 |
| Zapopan, MX | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Portland, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Edmonton, CA | 1 |
| SVK001location not on record | 1 |
| POL003location not on record | 1 |
| Forssa, FI | 1 |
| H-Schuhwlocation not on record | 1 |
| WNNUlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Anchorage, US | 1 |
| Londrina, BR | 1 |
| Santiago de Compostela, ES | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Brookings, US | 1 |
| Bogotá, D.C., CO | 1 |
| TADlocation not on record | 1 |
| NoColllocation not on record | 1 |
| Uberlândia, BR | 1 |
552 institutions · 31 586 of 34 778 vouchered records shown · 2 584 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA197 detections
Where the DNA of Plantago lanceolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found197
Studies independent surveys5
Countries22
Verifiable raw sequence linked2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 197 detections have coordinates
Open the map22 countries0
Dry calcareous grasslandsLarch forestcultivated in Botanic Garden; ORIGINAL_HABIT…scrublandStonyHumid meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature21.2 °C 5.23–25.4
pH8.18 6.79–8.58
Conductivity45,150 µS/cm 32,600–53,500
Salinity34.5 PSU 29.0–36.0
Dissolved oxygen6.68 mg/L 4.50–7.25
Turbidity0.838 NTU 0.049–6.90
Nitrate0.585 µmol/L 0.071–9.90
Depth2.00 m 0–1,000
PelagicSedimentCoastal water
67 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.7 °C 6.00–21.6
Seasonal swing summer↔winter11.3 °C
Max temp (day)19.4 °C 8.00–23.9
Min temp (night)13.9 °C 3.90–19.3
Precipitation78.9 mm/mo 59.0–114
Air humidity61.0 % 55.5–64.3
Moisture balance-40.0 mm/mo -83.2–104
Vapour deficit791 Pa 335–1,011
Wind speed3.70 m/s 2.40–6.10
Cloud cover30.1 % 16.3–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 174 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.