Planes minutus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Grapsidae/Planes

At a glance

Occurrence records1 842

Data sources9

Biological traits3

DNA specimens7

eDNA detections2

Sources9 archives

Databases and archives Planes minutus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 476 records↗

OBISOcean Biodiversity Information System366 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS1 842 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Planes minutus is a species of pelagic crab that lives in the North Atlantic Ocean. It is typically less than 10 mm long across the back, and is variable in colouration, to match its background. It may have been the crab seen by Christopher Columbus on Sargassum weed in the Sargasso Sea in 1492.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits1

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Planes minutus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BINs2

Most divergent pair0.16%

Where individuals differ — all 6 variable positions, in barcode order

258Cmostly conserved

327Cmostly conserved

348Tmostly conserved

372Gmostly conserved

376Tmostly conserved

387Tvariable

TTTATTTTTGGAGCTTGAGCTGGCATAGTAGGTACTTCTTTAAGTTTAATTATTCGAGCTGAATTAAGACAGCCTGGGAGATTAATTGGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gecarcoidea lalandiisame order12.7%Gecarcoidea natalissame order12.8%Pachygrapsus minutussame family13.8%Selatium brockiisame order14.3%Armases cinereumsame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 842 records

Wild obs. + sensor1 030

Museum / vouchered728

Other84

Origin

Native5

Range

Area of Occupancy AOO4 352 km²

Depth

0–200 m sunlit47

200–1000 m twilight2

1–4 km midnight1

>4 km abyssal1

median 0 m · max 9 249 m · 51 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 479≤1 km 129≤10 km 58>10 km 34

700 georeferenced · 330 without coordinates

Open the mapobservation + sensor1 030

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 13≤1 km 59≤10 km 56>10 km 42

170 georeferenced · 558 without coordinates

Open the institutions mapphysical evidence728

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	125
Washington, US	108
	34
New Haven, US	32
Zoologisches Museum Hamburglocation not on record	31
Cambridge, US	29
DASSHlocation not on record	16
Brussels, BE	14
IEO-COMA-CSIClocation not on record	13
ICM-CSIClocation not on record	13
Museum für Naturkunde Berlin (Zoological Collections)location not on record	11
Earth Sciences New Zealandlocation not on record	6
RBINS-Scientific Heritagelocation not on record	5
Frankfurt am Main	4
Museu de Zoologia da Universidade de Sao Paulolocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	4
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	4
Mexico City, MX	3
Auckland, NZ	3
Texas Cooperative Wildlife Collectionlocation not on record	3
Centre for Biodiversity Genomicslocation not on record	3
CASlocation not on record	3
Helsinki, FI	2
Stockholm, SE	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
Honolulu, US	2
UM-RSMASlocation not on record	2
Philadelphia, US	1
Paris, FR	1
The Atlantic reference Centrelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

31 institutions · 482 of 728 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Planes minutus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 18.1–18.1

Seasonal swing summer↔winter8.00 °C

Max temp (day)21.8 °C

Min temp (night)15.5 °C

Precipitation2.20 mm/mo

Air humidity64.4 %

Moisture balance-143 mm/mo

Vapour deficit740 Pa

Wind speed1.50 m/s

Cloud cover18.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Planes minutus

At a glance

Sources9 archives

Habitat & environment2

Other traits1

At a glance

Record type1 842 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 842 records