Plagiolepis pygmaea

(Latreille, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Plagiolepis

At a glance

Occurrence records3 450

Data sources10

Biological traits0

DNA specimens105

eDNA detections173

Sources10 archives

Databases and archives Plagiolepis pygmaea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI173 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics105 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 450 records

Environmental DNA1 datasets · 13 countries173 detections

DNA & barcodingBOLD105 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈335 Mbp

01Narrative

Plagiolepis pygmaea is a species of ant in the genus Plagiolepis. The species is widely distributed, from Portugal and the Canary Islands in the west, eastwards to Iran, Germany in the north and the Arabian peninsula in the south.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding105 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagiolepis pygmaea has left across the world's sequence archives.

At a glance

DNA specimens105

BINs8

Marker genes1

eDNA detections173

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

11Cmostly conserved

41Tmostly conserved

65Cmostly conserved

86Cmostly conserved

90Tmostly conserved

104Tmostly conserved

116Tmostly conserved

119Cmostly conserved

137Tmostly conserved

155Cmostly conserved

188Amostly conserved

191Cmostly conserved

227Gmostly conserved

269Amostly conserved

272Amostly conserved

284Cmostly conserved

285Cmostly conserved

287Tmostly conserved

291Cmostly conserved

317Amostly conserved

333Gmostly conserved

338Cmostly conserved

341Tmostly conserved

345Cmostly conserved

359Cmostly conserved

371Tmostly conserved

383Tmostly conserved

410Tmostly conserved

413Gmostly conserved

431Gmostly conserved

434Cmostly conserved

440Cmostly conserved

456Cmostly conserved

467Tmostly conserved

470Tmostly conserved

476Tmostly conserved

479Cmostly conserved

495Tmostly conserved

497Tmostly conserved

524Amostly conserved

530Cmostly conserved

531Tmostly conserved

533Amostly conserved

536Cmostly conserved

560Tmostly conserved

569Cmostly conserved

572Cmostly conserved

581Amostly conserved

641Tmostly conserved

TCTTATACTTCTTATTTGCTATTTGAGCAGGAATACTAGGTTCATCTATAAGAATAATTATTCGCTTAGAATTAGGCTCTCCTAACGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes18

BINs6

Most divergent pair10.8%

EuropeOtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagiolepis xenesame genus2.1%Plagiolepis tauricasame genus11.2%Lepisiota melassame family12.1%Plagiolepis schmitziisame genus12.5%Lepisiota nigrasame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Plagiolepis pygmaea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈334 655 090 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Plagiolepis pygmaea0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 91×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 450 records

Wild obs. + sensor2 464

Museum / vouchered986

Origin

Native589

Range

Area of Occupancy AOO5 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 194≤1 km 466≤10 km 1 025>10 km 28

1 713 georeferenced · 751 without coordinates

Open the mapobservation + sensor2 464

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 7≤1 km 64≤10 km 421>10 km 2

494 georeferenced · 492 without coordinates

Open the institutions mapphysical evidence986

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	250
CASlocation not on record	136
CEFElocation not on record	108
Zürich, CH	56
IMEDEAlocation not on record	49
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	42
NMOKlocation not on record	28
MNHWlocation not on record	26
EMTUlocation not on record	8
Cape Town, ZA	5
Royal British Columbia Museumlocation not on record	5
Durban Natural Science Museumlocation not on record	4
Barcelona, ES	3
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Chicago, US	2
EL PASO, US	1

16 institutions · 726 of 986 vouchered records shown · 260 without an institution code

09Environmental DNA173 detections

Where the DNA of Plagiolepis pygmaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found173

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 173 detections have coordinates

Open the map13 countries0

Olive orchardCity parks and large gardensrocky pastureForest and shrubby vegetationDry calcareous grasslandChenaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 11.2–21.1

Seasonal swing summer↔winter17.2 °C

Max temp (day)19.9 °C 15.3–25.8

Min temp (night)11.6 °C 6.20–16.1

Precipitation55.3 mm/mo 34.6–121

Air humidity57.7 % 53.9–61.2

Moisture balance-38.9 mm/mo -122–53.2

Vapour deficit809 Pa 608–1,155

Wind speed3.00 m/s 1.80–4.10

Cloud cover41.5 % 35.9–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 155 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Plagiolepis pygmaea

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 450 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 450 records